ZFIN ID: ZDB-TSCRIPT-091110-626
Transcript Name: mgst3a-201
Previous Names: mgst3a-002, prpf39-002, ch73-220d16.1-002, ottdart00000045013, zgc:56518-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045013 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045013|OTTDARG00000032264|ZDB-GENE-040426-2767 mgst3|OTTDARP00000035590 mgst3-002 LG_ CU915800.10 Danio rerio protein_coding KNOWN, 668 bp
AACCGAGTAGTGATCTTTTGTCTTCCAGCCTCCGCCCTGC
AAGCTCAGTAGTCAGAACAGCATTTAGATCCCGTTTTCTC
CTCAGTCGTGAAGATGGTGGTTTTATCTAAAGAGTACGGA
TATGTGGCGCTAACCGGAGCGGCGTCGTTTCTCCTGATGG
TTCATCTGGCACATGGCGTCGTGAAGGCTCGGAAGAAGTA
CAATGTCCCGTATCCAACAATGTACAGTGATGATCCAGAG
ACTGGCCGCATATTCAACTGTATCCAGCGAAGTCATCAGA
ACACTATTGAAATCCTGTCTCCATTCCTCTTTCATTTATC
TGTGGGTGGGATTCAGCATCCACGTCTGGCCAGTGTGTTG
GGGATGATCTGGATTGTCAGTCGGGTGCTTTACGCTCAAG
GATACTCTACTGGAAAGCCTCAAAAGCGCCACCGTGGGAC
TTTCGGTATGGTTGCTTTAGTGGGACTGTTCTTTTGCACA
GTGGACACCGGGAGAGTGATGCTCGGATGGGGACCTGGCA
TCAAATGGCCCAGATGTTTTAAATAATTCATATTTTTTAT
TATGCAATCTGATTCTATTCCAGTTTTACATTTTATAAAA
TTACCAGCAAACAAACAGCAATAATAAAAAAGCACACTGT
GTGTACATTTAAAAAAAAAAAAACGGTA

mgst3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mgst3a-201 668
mgst3a-202 (1)    Ensembl 472
mgst3a-203 (1)    Ensembl 586
mgst3a-205 (1)    Ensembl 722
ncRNA mgst3a-003 (1)    Ensembl 462
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mgst3a-201 Contained in:
[BAC] CH73-220D16 (1)

Genome Resources: Vega_Trans:OTTDART00000045013 (1),  Ensembl_Trans:ENSDART00000157871 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH490590 (1) 701 bp
GenBank:EH507923 (1) 674 bp
GenBank:EH497733 (1) 673 bp
GenBank:EH503570 (1) 668 bp
GenBank:EH509009 (1) 662 bp
GenBank:CF103275 (1) 615 bp
CITATIONS (2)