header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-2073
Transcript Name: mgst3a-205
Previous Names: mgst3a-001, ch73-137d22.1-002, ch73-220d16.1-001, ottdart00000045012, zgc:56518-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045012 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045012|OTTDARG00000032264|ZDB-GENE-040426-2767 mgst3|OTTDARP00000035589 mgst3-001 LG_ CU915800.10 Danio rerio protein_coding KNOWN, 722 bp
GTAATTCATTTCATAGACTATATATAGGCTACTGTTGTAC
TCGACATTACACGGTTGCTAGCTTAGAGGTCACACATTTT
CTAAACCTGTTGTGCACTTCTGTTATCTATCACACACAGC
ATTTAGATCCCGTTTTCTCCTCAGTCGTGAAGATGGTGGT
TTTATCTAAAGAGTACGGATATGTGGCGCTAACCGGAGCG
GCGTCGTTTCTCCTGATGGTTCATCTGGCACATGGCGTCG
TGAAGGCTCGGAAGAAGTACAATGTCCCGTATCCAACAAT
GTACAGTGATGATCCAGAGACTGGCCGCATATTCAACTGT
ATCCAGCGAAGTCATCAGAACACTATTGAAATCCTGTCTC
CATTCCTCTTTCATTTATCTGTGGGTGGGATTCAGCATCC
ACGTCTGGCCAGTGTGTTGGGGATGATCTGGATTGTCAGT
CGGGTGCTTTACGCTCAAGGATACTCTACTGGAAAGCCTC
AAAAGCGCCACCGTGGGACTTTCGGTATGGTTGCTTTAGT
GGGACTGTTCTTTTGCACAGTGGACACCGGGAGAGTGATG
CTCGGATGGGGACCTGGCATCAAATGGCCCAGATGTTTTA
AATAATTCATATTTTTTATTATGCAATCTGATTCTATTCC
AGTTTTACATTTTATAAAATTACCAGCAAACAAACAGCAA
TAATAAAAAAGCACACTGTGTGTACATTTAAAAAAAAAAA
AA

mgst3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mgst3a-201 (1)    Ensembl 668
mgst3a-202 (1)    Ensembl 472
mgst3a-203 (1)    Ensembl 586
mgst3a-205 722
ncRNA mgst3a-003 (1)    Ensembl 462
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mgst3a-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045012 (1),  Ensembl_Trans:ENSDART00000170894 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH539080 (1) 747 bp
GenBank:BC049037 (1) 709 bp
GenBank:EB797837 (1) 276 bp
CITATIONS (2)