header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-566
Transcript Name: cdk5-201
Previous Names: cdk5-001, dkeyp-27g9.2-001, ottdart00000044693

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044693 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044693|OTTDARG00000032053|ZDB-GENE-010131-2 cdk5|OTTDARP00000035363 cdk5-001 LG_ CU019563.16 Danio rerio protein_coding KNOWN, 1899 bp
GTAGCTCTGCTCTCTTCATGTTGCGTACTACGCCCCTTGT
TGATAAAAAACGACATTAATCAGCGGTACAATTAAACCCC
TGCTTATTAATTCGTAGAAAAAACGAGCAGCCAGGACGTT
TTAATAACTGGCTGAAACCATGCAAAAGTATGAGAAGCTG
GAGAAGATAGGAGAGGGTACATATGGTACCGTTTTCAAGG
CTAAAAACAGAGAAACGCACGAAATTGTGGCCCTCAAACG
AGTCCGACTGGATGATGATGATGAGGGCGTACCAAGTTCA
GCTTTACGAGAAATTTGCCTCCTGAAAGAACTGAAGCATA
AAAACATTGTAAGGTTACATGACGTCCTTCACAGTGATAA
GAAACTCACATTAGTGTTTGAATACTGTGATCAGGATTTG
AAGAAATACTTTGACAGCTGTAATGGTGACTTGGATCCAG
AGATTGTCAAGTCTTTTATGTACCAGTTGTTGAAGGGTCT
CGCCTTCTGCCACAGCAGAAATGTTCTCCACCGTGACCTT
AAACCACAAAACCTGCTCATCAACAGAAACGGGGAACTGA
AGTTGGCTGATTTCGGCTTGGCCAGAGCGTTTGGGATCCC
TGTACGCTGTTATTCTGCTGAGGTGGTGACGTTGTGGTAC
AGGCCTCCGGATGTACTGTTTGGTGCTAAACTCTACTCTA
CCTCTATCGACATGTGGTCTGCAGGCTGTATATTTGCAGA
ACTGGCAAATGCAGGACGGCCTTTATTTCCTGGTAACGAT
GTGGACGATCAGCTAAAGAGGATCTTTCGATTGCTGGGAA
CGCCAACAGAAGAACAGTGGCAGACTATGAATAAACTTCC
AGATTATAAGCCGTACCCGATGTATCCAGCTACTACATCA
CTTGTGAACGTCGTGCCGAAACTCAGCAGCACCGGCAGAG
ATTTACTACAGAATCTTCTGAAATGTAATCCAGTACAGCG
AATCTCAGCAGAAGAAGCTCTACAGCACCCTTACTTTGCT
GATTTCTGCCCACCATAAAAAAACAAAAACAAAAACTGCT
CTCCAAATCATCATGTAGGAACACAGACGGGCCAGTTTTA
CCTCCTCAAACCCCCCTCAGCTTCTGCTTTCACCATAGGA
TAATAGAGGGACCACCAGACACTCCTCCATTAGTGATTAT
GGTTATGATTTGATCATACAGACATGATTATAATAGTGAC
TCTCTCTAATGCAGAGTGTGCTGCTGTTATTCGGCACAAA
TCTCCAAAAAGACCTTTATGTTGTTACTATGGTCTTAAAG
GGATAGTTCATCAAAAATCAATTTGACATATTTCTTCATT
AACAAAATGTGTGTTTTTAGCTGAAACACTGGTCATTGGG
TGATTTATAAAATGCAAGTCAACAGCACTTTGGGAGTCAA
AAAAAACACATACAGGCAAAATTAAAGGGATAGTTCACCC
AAAACTGAAAATGCGTTATTCACTCTCTATTCAAAACCTT
CATTCTGTTGAACATAAAAGAAGACATTTCGAAGAATGCT
GGAAACCTGTAATCATTGACTTCCATAGCATTTGTTTTTC
CTGCTATGGGTATCAATAGTACATCAGAAACGTGTTCAAC
ATAATGAAGAAACACATAAAGGTTTGGAGTAAACAGTGAG
AATTTGTTTTTGACTGAACTGTGCCTTTAATGATTGGAAT
AGTTGATTCCATGAGCATTATGAACTTCATTGTGTTTTAT
AAGACCTCAATTTATTGTCCAGAGCTGAATATATATGTAT
TTTGATTAGCCTGTATGTTATTTATTTATGTATTTATTTT
TGACTCCATATCTTACTTGCAGTTTTATGAATCAACAAGG
ATCACAGTTTAAACCATAAGTCTTTTAATGTGTCACTGAA
TTAAAAGAAAGCGACCGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdk5-201 Contained in:
[BAC] DKEYP-87A6 (1)

OTHER cdk5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044693 (1)
  • Ensembl_Trans:ENSDART00000079210 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF203736 (1) 2880 bp
    GenBank:BC085381 (1) 1899 bp
    GenBank:CN502492 (1) 892 bp
    GenBank:CN843976 (1) 864 bp
    GenBank:DV584571 (1) 739 bp
    GenBank:BM571801 (1) 647 bp
    GenBank:EB768881 (1) 396 bp
    CITATIONS (2)