Transcript

asic1c-201

ID
ZDB-TSCRIPT-091110-561
Name
asic1c-201
Previous Names
  • accn2c-001
  • asic1c-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044689|OTTDARG00000032050|ZDB-GENE-040513-3 asic1c|OTTDARP00000035360 accn2c-001 LG_ CU019563.16 Danio rerio protein_coding KNOWN, 748 bp
GCTGCTGTATCTTCCTCCGCCGTGGGGCGACTGCAGATCC
GCACCGATGGACTCGGAGTATTTCTCCACTTACAGCATCA
CTGCCTGCCGGATCGACTGCGAGACCCGATACCTGCTGGA
GAACTGCAACTGCAGGATGGTGCACATGCCAGGCACCTCA
ACCGTCTGCACACCTGAGCAGTACAAAGACTGTGCCGATC
CAGCTTTAGATTTTCTGGTGGAGAAGGACAATGATTACTG
TGTGTGTGATACGCCGTGCAACATGACTCGATACGGTAAA
GAGCTGTCAATGGTGAAGATCCCCAGCAAAGCCTCTGCTA
AATACCTGGCCAAGAAATTCAACAAAACAGAGCAGTACAT
CACGGACAATATACTTGTACTGGATATCTTTTTTGAGGCT
CTGAATTATGAGAAAATTGAACAAAAGAAAGCATACGAAG
TCGCTGGGTTACTTGGTGATATCGGTGGTCAGATGGGTCT
GTTTATAGGAGCCAGTGTATTGACTATATTGGAGATATTT
GATTATTTGTATGAGGTTTTGAAGGATAAAATTCTGGGAT
CTGTTCTACGCAAGAGAAGACCACACCGGAGCGCCAGTGA
CAATCTGGTAATTGTTTCTCTGCATGACTTTAAAATAAGC
TCAGTGTTTTTGTTGGCTAGTTATATGTGTTTTGTGTGTT
ATATTGTCCTCTTGAATGCTGCATGTGTCTATTTGCCTTT
TGTCGTTGGCTCAAATTCTGGGAAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations