ZFIN ID: ZDB-TSCRIPT-091110-561
Transcript Name: asic1c-201
Previous Names: accn2c-001, asic1c-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044689 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044689|OTTDARG00000032050|ZDB-GENE-040513-3 asic1c|OTTDARP00000035360 accn2c-001 LG_ CU019563.16 Danio rerio protein_coding KNOWN, 748 bp
GCTGCTGTATCTTCCTCCGCCGTGGGGCGACTGCAGATCC
GCACCGATGGACTCGGAGTATTTCTCCACTTACAGCATCA
CTGCCTGCCGGATCGACTGCGAGACCCGATACCTGCTGGA
GAACTGCAACTGCAGGATGGTGCACATGCCAGGCACCTCA
ACCGTCTGCACACCTGAGCAGTACAAAGACTGTGCCGATC
CAGCTTTAGATTTTCTGGTGGAGAAGGACAATGATTACTG
TGTGTGTGATACGCCGTGCAACATGACTCGATACGGTAAA
GAGCTGTCAATGGTGAAGATCCCCAGCAAAGCCTCTGCTA
AATACCTGGCCAAGAAATTCAACAAAACAGAGCAGTACAT
CACGGACAATATACTTGTACTGGATATCTTTTTTGAGGCT
CTGAATTATGAGAAAATTGAACAAAAGAAAGCATACGAAG
TCGCTGGGTTACTTGGTGATATCGGTGGTCAGATGGGTCT
GTTTATAGGAGCCAGTGTATTGACTATATTGGAGATATTT
GATTATTTGTATGAGGTTTTGAAGGATAAAATTCTGGGAT
CTGTTCTACGCAAGAGAAGACCACACCGGAGCGCCAGTGA
CAATCTGGTAATTGTTTCTCTGCATGACTTTAAAATAAGC
TCAGTGTTTTTGTTGGCTAGTTATATGTGTTTTGTGTGTT
ATATTGTCCTCTTGAATGCTGCATGTGTCTATTTGCCTTT
TGTCGTTGGCTCAAATTCTGGGAAATGA

asic1c TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA asic1c-201 748
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asic1c-201 Contained in:
[BAC] DKEYP-87A6 (1)

Genome Resources: Vega_Trans:OTTDART00000044689 (1),  Ensembl_Trans:ENSDART00000159840 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AJ609617 (1) 1602 nt
CITATIONS (2)