Transcript

dusp22b-002

ID
ZDB-TSCRIPT-091110-551
Name
dusp22b-002
Previous Names
  • ch211-253b1.4-003
  • ottdart00000044646
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044646 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044646|OTTDARG00000032017|ZDB-GENE-050417-257 dusp22b|no_translation dusp22b-002 LG_ CT962510.11 Danio rerio protein_coding KNOWN, 846 bp
TTACCGCCAAAACATAACTCGACCGTGTGGCTGAACGCCA
TTTTGGAATTAAAATCTTCTGTTTACATTCTGAGCAGAAC
TTTATTAGGTTCTGCCTGACCTGTACTTGGGTAATTTCAA
AGATGCCAGAGATCGTGAGCAGTTGGCCAGAAACAACATC
ACACACATCCTCTCCATCCACGATACTGCAGCGCCCATAT
TACAGGAGATGACTTATCTGTGTATCGCAGCAGCAGATTC
GCCCACACAGAACCTCATCCAGCACTTTAGGCAGAGCATT
GCGTTCATTCACCAATCTCGACTGAAAGGGGAAGGCTGTC
TAGTTCACTGTTTGGCAGGAGTTTCCCGTAGCGTGACGCT
GGTGGTGGCCTACATCATGACCGTCACCACGCTGGGCTGG
CAGGAGGCTCTGGCTGCGGTGAAGATAGCGAGACCTTGTG
CTTCACCAAACACCGGCTTCCAGAACCAACTGCAGGAGTT
TCAGACTGGAGAACTACAGCAGTTCAGAGAGTGGCTGAAG
GAGGAGTACAAGGAAAACCCTTTTAATGATGAGGAGGACA
TTCGCAATTTGCTGACAAAAGCATCGACGGAGGAGGACGC
AGAGCTGCAGAACAACTAAGACACACACACACACACACAC
ACACACACACACACACATTCCTCTCTGCTGGTTATGGCGA
AGCACTGTTTAACTTATCCACACTTTTTTTGTAAATAAGA
CATATGCAAGGTTTTAATGTTTACTACTGAAGCGATGTTA
AAGGGTCAGTTCACCCAGAAATGAGCATTCTGTCATCGTT
TACTCTCCCTTTCTTTCTTCGGTTGAACACCAAGATGCTT
TGAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations