Transcript

dusp22b-201

ID
ZDB-TSCRIPT-091110-1998
Name
dusp22b-201
Previous Names
  • dusp22b-001
  • ch211-230g15.5-004
  • ottdart00000044645
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044645 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044645|OTTDARG00000032017|ZDB-GENE-050417-257 dusp22b|OTTDARP00000035307 dusp22b-001 LG_ CT962510.11 Danio rerio protein_coding KNOWN, 1242 bp
AATATTATCGATTAGAAACTGTCGATACGAGCCTCGTTTC
AAGCGGAATCCTGCAATACCGGCCACCGCACACACCGTGG
CATGGGAAACGGCATTAATAAGGTTCTGCCTGACCTGTAC
TTGGGTAATTTCAAAGATGCCAGAGATCGTGAGCAGTTGG
CCAGAAACAACATCACACACATCCTCTCCATCCACGATAC
TGCAGCGCCCATATTACAGGAGATGACTTATCTGTGTATC
GCAGCAGCAGATTCGCCCACACAGAACCTCATCCAGCACT
TTAGGCAGAGCATTGCGTTCATTCACCAATCTCGACTGAA
AGGGGAAGGCTGTCTAGTTCACTGTTTGGCAGGAGTTTCC
CGTAGCGTGACGCTGGTGGTGGCCTACATCATGACCGTCA
CCACGCTGGGCTGGCAGGAGGCTCTGGCTGCGGTGAAGAT
AGCGAGACCTTGTGCTTCACCAAACACCGGCTTCCAGAAC
CAACTGCAGGAGTTTCAGACTGGAGAACTACAGCAGTTCA
GAGAGTGGCTGAAGGAGGAGTACAAGGAAAACCCTTTTAA
TGATGAGGAGGACATTCGCAATTTGCTGACAAAAGCATCG
ACGGAGGAGGACGCAGAGCTGCAGAACAACTAAGACACAC
ACACACACACACACACACACACACACACACATTCCTCTCT
GCTGGTTATGGCGAAGCACTGTTTAACTTATCCACACTTT
TTTTGTAAATAAGACATATGCAAGGTTTTAATGTTTACTA
CTGAAGCGATGTTAAAGGGTCAGTTCACCCAGAAATGAGC
ATTCTGTCATCGTTTACTCTCCCTTTCTTTCTTCGGTTGA
ACACCAAGATGCTTTGAAGAATGTTTGAAAACTGTAACCA
TTGACTTTTTGTCTGCTATGGAAGCCAATGGTTACCGGTT
TTCAGCTTGTTGTTCAAGAGAATAGTTTAAGGGAGAGTAG
ATCGAGAGTAACTTCAGATTTTGGGGTGAGCTGGCTGTTT
AAAGGGAGTTTTAGTTGTTCGGTATTTACAGGTGTGTTAT
TATAAAAGGATTTATACTGACTGTTTGTATTAAATGTTCA
TCGTTTATTAAGCAGCATGTTGTTTAATTCATCTTTGGAT
GACAAATAATATATTTTTAATGAAACCACAGAGATATTTC
TGTTCTGCCGTTGATTGTTAATTCAGCTAAACTCACTACA
CACTCCAAAGCATTTCTAAATAAATAAAGATATGTTTATG
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations