ZFIN ID: ZDB-TSCRIPT-091110-537
Transcript Name: palmdb-002
Previous Names: palmd-002, ch211-254e10.1-002, dkeyp-7a3.2-001, ottdart00000044588

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044588 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044588|OTTDARG00000031979|ZDB-GENE-090713-3 palmdb|no_translation CH211-254E10.1-002 LG_ CR352310.15 Danio rerio protein_coding NOVEL, 925 bp
ACTTACCACACATACATGCAAACATGCTGGAATGAACAGA
CTGAATTCCGGTCGGCGCTTCCCAACTAAAACCATCAGCA
GAAGATAGCCGGATCATAATGGAGGAAGAAACCCTGCTGC
GAGAGAGACTGCAGGCTATAACAGACAAAAGAAGAATTCG
AGAGGAAATAGAAAAGAAACGAAGAAGCATTGAAGAAGAG
AAATTAAACCTACAATATCTAAAGAAAAAAACTCTCCGGG
AGCAATGGCTGATGGACGGGCTGAGCACTTTAACCGAAGA
GGAGCAGGAGTCGGCGAAGGCCCAGACAGAAGACAACCAA
CAGCAGACTAAAGTCCTGCAGAGCAACATCCACAGAATAG
AGCTGGAGATTGCGGCCCTTGAGACACAAGAGCTGGAGAT
TTCAGCGAAAGAAGAGCTTCTTCTGAAACAACTGAAGGAG
GTGGAGAAAACCCCAGCGGACATCATAAAGGTAGCGCTTG
TGTAATCACTTTAACAGGCCTGGAGTCTCCTTTATCGCTT
ATTACAACAGCAAGCAGCTTCAATTGGATCCGCTTTTGAG
TTGGAACAAGGGAAATCATTAGAATTCAGCATGCTGTGAA
GATGGCCCTCGGTTCCAAACTGACGTCAAGATAAAAATTG
TTTGATGCTGTGAGACAAGGATCTGTGTGTATCATCTGTG
TATGAAACTTGGTTTTGCTTTATATCTTCTTATCTTTTCA
TCAAATCCGGTTTACTGCGCAAACTACTGTATTGACCCCA
CAGGAAGTAAACGCAAACATGCAGCCAGGTAAAGAAATTT
CTTCTTTTTTTTCTGCATTGCCATATACAGTTGAAGGCAA
AAATATTAGCCCTCCTGGGAATTTCTTTTTTAAATATTTC
TAAAATTATTTTTAACAGAGCAAGGAACTTTTCACAGTAT
GTCTG

palmdb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA palmdb-201 (1)    Ensembl 430
ncRNA palmdb-002 925
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
palmdb-002 Contained in:
[BAC] CH211-254E10 (1)

Genome Resources: Vega_Trans:OTTDART00000044588 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH506063 (1) 952 nt
CITATIONS (1)