ZFIN ID: ZDB-TSCRIPT-091110-1984
Transcript Name: palmdb-201
Previous Names: palmd-001, palmdb-001, ch211-254e10.1-001, dkey-225n3.4-001, ottdart00000044587

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044587 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044587|OTTDARG00000031979|ZDB-GENE-090713-3 palmdb|OTTDARP00000035233 CH211-254E10.1-001 LG_ CR352310.15 Danio rerio protein_coding NOVEL, 430 bp
TTCCGGTCGGCGCTTCCCAACTAAAACCATCAGCAGAAGA
TAGCCGGATCATAATGGAGGAAGAAACCCTGCTGCGAGAG
AGACTGCAGGCTATAACAGACAAAAGAAGAATTCGAGAGG
AAATAGAAAAGAAACGAAGAAGCATTGAAGAAGAGAAATT
AAACCTACAATATCTAAAGAAAAAAACTCTCCGGGAGCAA
TGGCTGATGGACGGGCTGAGCACTTTAACCGAAGAGGAGC
AGGAGTCGGCGAAGGCCCAGACAGAAGACAACCAACAGCA
GACTAAAGTCCTGCAGAGCAACATCCACAGAATAGAGCTG
GAGATTGCGGCCCTTGAGACACAAGAGCTGGAGATTTCAG
CGAAAGAAGAGCTTCTTCTGAAACAACTGAAGGAGGTGGA
GAAAACCCCAGCGGACATCATAAAGGTAGC

palmdb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA palmdb-201 430
ncRNA palmdb-002 (1) 925
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
palmdb-201 Contained in:
[BAC] CH211-254E10 (1)

Genome Resources: Vega_Trans:OTTDART00000044587 (1),  Ensembl_Trans:ENSDART00000135094 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)