Transcript

palmdb-201

ID
ZDB-TSCRIPT-091110-1984
Name
palmdb-201
Previous Names
  • palmd-001
  • palmdb-001
  • ch211-254e10.1-001
  • dkey-225n3.4-001
  • ottdart00000044587
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044587 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044587|OTTDARG00000031979|ZDB-GENE-090713-3 palmdb|OTTDARP00000035233 CH211-254E10.1-001 LG_ CR352310.15 Danio rerio protein_coding NOVEL, 430 bp
TTCCGGTCGGCGCTTCCCAACTAAAACCATCAGCAGAAGA
TAGCCGGATCATAATGGAGGAAGAAACCCTGCTGCGAGAG
AGACTGCAGGCTATAACAGACAAAAGAAGAATTCGAGAGG
AAATAGAAAAGAAACGAAGAAGCATTGAAGAAGAGAAATT
AAACCTACAATATCTAAAGAAAAAAACTCTCCGGGAGCAA
TGGCTGATGGACGGGCTGAGCACTTTAACCGAAGAGGAGC
AGGAGTCGGCGAAGGCCCAGACAGAAGACAACCAACAGCA
GACTAAAGTCCTGCAGAGCAACATCCACAGAATAGAGCTG
GAGATTGCGGCCCTTGAGACACAAGAGCTGGAGATTTCAG
CGAAAGAAGAGCTTCTTCTGAAACAACTGAAGGAGGTGGA
GAAAACCCCAGCGGACATCATAAAGGTAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations