Transcript

flj11011l-202

ID
ZDB-TSCRIPT-091110-492
Name
flj11011l-202
Previous Names
  • dkeyp-28d2.6-001
  • flj11011l-001
  • trpa1b-002
  • ottdart00000044413
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044413|OTTDARG00000031883|ZDB-GENE-050113-1 flj11011l|OTTDARP00000035114 DKEYP-28D2.6-001 LG_ CR405710.10 Danio rerio protein_coding NOVEL, 825 bp
TTTAATCTATCAATCACTCCTTGATCAGGTGTTGGGTCTG
TCGTTTCTGCTCATGTAAATGCTGTTTGTCGGATACGCCG
TTAAAGGGGGTCGAATATTGCTTTATCAGTTCTGAATTCA
TAACTTGTCCTCCTCGCTGCTCCTGATCTGTCAGGAAAAG
GTTACAGAAGGAGCTGCTAGCCTTGCAGAATGATCCACCC
CCTGGAATGACCCTAAACGAGAAGAGCGTACAAAACACCA
TTACACAATGGATAGTGGACATGGAAGGAGCCTCTGGTAC
TGTTTATGAAGGGGAAAAATTCCAGCTTCTTTTTAAATTT
AGTAGTCGTTATCCCTTTGACTCGCCTCAGGTAATGTTCA
CAGGAGACAATATACCTGTCCATCCCCACGTTTATAGCAA
TGGCCACATCTGCCTGTCCATCTTAACGGAGGACTGGTCA
CCAGCCCTTTCAGTCCAGTCTGTTTGTCTTAGCATTATTA
GCATGCTGTCCAGCTGCAAAGAGAAGAGACGGCCTCCTGA
TAATTCATTTTATGTACGAACTTGTAATAAAAATCCAAAG
AAGACAAAATGGTGGTATCATGATGATACCTGTTAATATG
AACTTTCTTGAACTCCAAGAGGGAAGAAGTTCTACTGACC
TATAGAAGCACTTTTTTGAATATCATATGGTCTCTGAACT
TTAACCTTGGACTCAAACTAAAGCATGGACTCCTGTGGAC
CACAAACACGGGAAACGATGTCAGCTGTGTTACTGGTAGC
CAGTTGGATGCATGTTTGGGGGTTAACAAAAGAGATGACG
AATGGAAATAAATTATAAACAGAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations