ZFIN ID: ZDB-TSCRIPT-091110-492
Transcript Name: flj11011l-202
Previous Names: dkeyp-28d2.6-001, flj11011l-001, trpa1b-002, ottdart00000044413

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044413 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044413|OTTDARG00000031883|ZDB-GENE-050113-1 flj11011l|OTTDARP00000035114 DKEYP-28D2.6-001 LG_ CR405710.10 Danio rerio protein_coding NOVEL, 825 bp
TTTAATCTATCAATCACTCCTTGATCAGGTGTTGGGTCTG
TCGTTTCTGCTCATGTAAATGCTGTTTGTCGGATACGCCG
TTAAAGGGGGTCGAATATTGCTTTATCAGTTCTGAATTCA
TAACTTGTCCTCCTCGCTGCTCCTGATCTGTCAGGAAAAG
GTTACAGAAGGAGCTGCTAGCCTTGCAGAATGATCCACCC
CCTGGAATGACCCTAAACGAGAAGAGCGTACAAAACACCA
TTACACAATGGATAGTGGACATGGAAGGAGCCTCTGGTAC
TGTTTATGAAGGGGAAAAATTCCAGCTTCTTTTTAAATTT
AGTAGTCGTTATCCCTTTGACTCGCCTCAGGTAATGTTCA
CAGGAGACAATATACCTGTCCATCCCCACGTTTATAGCAA
TGGCCACATCTGCCTGTCCATCTTAACGGAGGACTGGTCA
CCAGCCCTTTCAGTCCAGTCTGTTTGTCTTAGCATTATTA
GCATGCTGTCCAGCTGCAAAGAGAAGAGACGGCCTCCTGA
TAATTCATTTTATGTACGAACTTGTAATAAAAATCCAAAG
AAGACAAAATGGTGGTATCATGATGATACCTGTTAATATG
AACTTTCTTGAACTCCAAGAGGGAAGAAGTTCTACTGACC
TATAGAAGCACTTTTTTGAATATCATATGGTCTCTGAACT
TTAACCTTGGACTCAAACTAAAGCATGGACTCCTGTGGAC
CACAAACACGGGAAACGATGTCAGCTGTGTTACTGGTAGC
CAGTTGGATGCATGTTTGGGGGTTAACAAAAGAGATGACG
AATGGAAATAAATTATAAACAGAAC

flj11011l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA flj11011l-201 (1)    Ensembl 2940
flj11011l-202 825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
flj11011l-202 Contained in:
[BAC] DKEYP-28D2 (1)

Genome Resources: Vega_Trans:OTTDART00000044413 (1),  Ensembl_Trans:ENSDART00000129309 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH548207 (1) 869 nt
CITATIONS (2)