Transcript

flj11011l-201

ID
ZDB-TSCRIPT-091110-1221
Name
flj11011l-201
Previous Names
  • dkey-172h9.1-001
  • dkeyp-28d2.6-002
  • flj11011l-002
  • ottdart00000044414
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044414 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044414|OTTDARG00000031883|ZDB-GENE-050113-1 flj11011l|OTTDARP00000035115 DKEYP-28D2.6-002 LG_ CR405710.10 Danio rerio protein_coding NOVEL, 2940 bp
ACTGATGCAGGGGGATCCATCATGGCGTCGATGCAGAAAA
GGTTACAGAAGGAGCTGCTAGCCTTGCAGAATGATCCACC
CCCTGGAATGACCCTAAACGAGAAGAGCGTACAAAACACC
ATTACACAATGGATAGTGGACATGGAAGGAGCCTCTGGTA
CTGTTTATGAAGGGGAAAAATTCCAGCTTCTTTTTAAATT
TAGTAGTCGTTATCCCTTTGACTCGCCTCAGGTAATGTTC
ACAGGAGACAATATACCTGTCCATCCCCACGTTTATAGCA
ATGGCCACATCTGCCTGTCCATCTTAACGGAGGACTGGTC
ACCAGCCCTTTCAGTCCAGTCTGTTTGTCTTAGCATTATT
AGCATGCTGTCCAGCTGCAAAGAGAAGAGACGGCCTCCTG
ATAATTCATTTTATGTACGAACTTGTAATAAAAATCCAAA
GAAGACAAAATGGTGGTATCATGATGATACCTGTTAATAT
GAACTTTCTTGAACTCCAAGAGGGAAGAAGTTCTACTGAC
CTATAGAAGCACTTTTTTGAATATCATATGGTCTCTGAAC
TTTAACCTTGGACTCAAACTAAAGCATGGACTCCTGTGGA
CCACAAACACGGGAAACGATGTCAGCTGTGTTACTGGTAG
CCAGTTGGATGCATGTTTGGGGGTTAACAAAAGAGATGAC
GAATGGAAATAAATTATAAACAGAACGGAAACGGACCATC
ATTGGTAGTTGTGAAGAAATTTTGTTTCATCCAGGATTTT
ATTATTATTTTATTTTGATAGTAAGATTACCACACCACAC
TGTTCATTTTCTGTCTCTAGTTTGTTTTAAGCTCCACGTG
TCTTGTGCAATAACAAGAATTTGGGTGCATTTTCAGGGCC
AATAATGAGAAATCCAAATCAATAGTCACGATCCAAAACA
AATACTGAAATGATTGTAGTGTTCCTTCGCTTTACTTTCA
TTCCTACTGAAATGATATGCACTGTGAAATGATATAAGAA
AAGAAAGGTTTGTTTAGGAGGTTGAATTTCTGATGAATCG
CTGTAAATAGTTTAATATACAAATGGTACGTTTTGTTCTC
ATTCATCTCAAGTTCTGATATCACTGCATATGGAGGTTAG
TCTCTGAGTCTTCTTTGGACTTTATTTGGTGCATTTAAGC
ATTAAAACCAACCTTGATCATCAATCAATCTCATACTTAC
CTCTACTAACTCCTACCGGATGAAACCAGGGCCTAAAACT
AAATTGCTGTTGTTTAGTATATGATACTAATGGTATTAAT
AATGGCTGAGAAAGCAATATGGTTCAGTATGATTATGAAA
ACTTTACAGAAAACTAGTATTCAGTATTTTGAAGCAGCTT
GCTGTGTATTTGAAAAGGCAAACATTTTCCCAGGTTTAGA
TTGAAAATAGTTCATAAATGGGCTGCCAATAAAACAGAAT
CCTTTCAAAATAGTAGTAATCTCCTCCAAAATAAAAGCTT
TGTTGTTTAACTTAAAAGCTAATAAAATAATCTATATAAA
ATCAAACGATAATAATTGCAATGACATGTTTTGCCTCTAT
TTACCTCAATTATGCATTGCTTTTGGGCCAGTAAAATATT
TATTGTATTGTGATAGATTTTCTCAAATGTTTTTGCTTAG
TTTTAGGCCCTGGACACAGAAGTATTCAGTGTAGATTTGC
AGTGCTTGGTAAACCAGTATATTGAATGTTGGCAAGAAAG
TTCTGTCTTGTGTTCTATCTTATTTGTATAAAATCTTTTT
TACGAGATTGAGTTTGCTCAAATATCTTTTAAATATTCCA
ATTTTCTTTTCTTTCCATGTTTTTACTTTATCGAAAGTAA
CCAATAAGATTTGAAAAATGGCAGTATGTTTGGGATTGTA
CATCTTATTTAATTCGAGGTTCCTGTTTTATTCTTTGTAA
CCTCAAATGTAACCTTTTTGGAAGTCATTGCAATTTTTGT
ATATTCTCAAGGTGTTGATTATCCTGGTCATACTTGTCTG
GCTCAGGTATTTTTATTTTGTTTTTTAAGGATGAAAAAAA
AAAACTGAAATATTTTCCATTTGACTATATTTTCTCCTCA
AGGACTGTTACATAGTTTAGGAAACGAATGGAACAAATCG
ATTTATGTAACTTTAAAAGTAAAAATTATTAGCATGGACT
ACATGTAGATATAGGCAAATTATGATATTGCACAGCACAT
ACACAGTTATTTCAAATTAAATTATATAATTTAGTTTTCC
TGAAAATTTGTTGCTAGGGTCAATGATTATGAGGTTTGGC
TTTTATGTTATCTGGGATTAAATAAGAAAGAAAGAAAAAA
ACAAAAAAACAAAGTAGTACCCAACTATATGTATATGTTT
GACAAACAAATTCTGACCAGAAATGAGAAATTTTACACTG
TTTATGAACTTCTCACACTCCAAAGATGTATTTTTTAGCC
ATCTCTTCAGAAATACTTGAATATTCCACAGCTGGTTGGC
TTGTCATCTTTTTTTTTATTTTTTTTTTCCATTGTCTGTG
GCACAGTGTATTTAGACCTCCTAGTGAATGTGTTGGTGTA
GAACACATGGAGATGGCCATGACTCTTCCCTCTGCACACA
TTATCAGGATATTTTATTTGATCAATTGTTCTTGCTACTA
AACGAAAATGTGTGGAAATGAAACCACGGCTAAACTTGAA
TGTGTGATTGATGGCAGAGAATTGTGCGTCATCATTTAAA
AGGAAGTCAATTAATGTACACGCTTAAGGTTAAGTATACA
CTTGGGTATATATATATAATAAATCTTTTTTTTTTGTTAT
AATGAAGGGTTCTATTTAAATTTTGGTTTGCAAGATGTAA
GAAGTAATAAGAGATTTTTTTTCTTTCATTGAGTTTTTTG
GTATGTATACAAATTATGTAACTTGTGCCTGTTAATTTTA
AGAATAAAAATACAGGTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations