ZFIN ID: ZDB-TSCRIPT-091110-1221
Transcript Name: flj11011l-201
Previous Names: dkey-172h9.1-001, dkeyp-28d2.6-002, flj11011l-002, ottdart00000044414

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044414 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044414|OTTDARG00000031883|ZDB-GENE-050113-1 flj11011l|OTTDARP00000035115 DKEYP-28D2.6-002 LG_ CR405710.10 Danio rerio protein_coding NOVEL, 2940 bp
ACTGATGCAGGGGGATCCATCATGGCGTCGATGCAGAAAA
GGTTACAGAAGGAGCTGCTAGCCTTGCAGAATGATCCACC
CCCTGGAATGACCCTAAACGAGAAGAGCGTACAAAACACC
ATTACACAATGGATAGTGGACATGGAAGGAGCCTCTGGTA
CTGTTTATGAAGGGGAAAAATTCCAGCTTCTTTTTAAATT
TAGTAGTCGTTATCCCTTTGACTCGCCTCAGGTAATGTTC
ACAGGAGACAATATACCTGTCCATCCCCACGTTTATAGCA
ATGGCCACATCTGCCTGTCCATCTTAACGGAGGACTGGTC
ACCAGCCCTTTCAGTCCAGTCTGTTTGTCTTAGCATTATT
AGCATGCTGTCCAGCTGCAAAGAGAAGAGACGGCCTCCTG
ATAATTCATTTTATGTACGAACTTGTAATAAAAATCCAAA
GAAGACAAAATGGTGGTATCATGATGATACCTGTTAATAT
GAACTTTCTTGAACTCCAAGAGGGAAGAAGTTCTACTGAC
CTATAGAAGCACTTTTTTGAATATCATATGGTCTCTGAAC
TTTAACCTTGGACTCAAACTAAAGCATGGACTCCTGTGGA
CCACAAACACGGGAAACGATGTCAGCTGTGTTACTGGTAG
CCAGTTGGATGCATGTTTGGGGGTTAACAAAAGAGATGAC
GAATGGAAATAAATTATAAACAGAACGGAAACGGACCATC
ATTGGTAGTTGTGAAGAAATTTTGTTTCATCCAGGATTTT
ATTATTATTTTATTTTGATAGTAAGATTACCACACCACAC
TGTTCATTTTCTGTCTCTAGTTTGTTTTAAGCTCCACGTG
TCTTGTGCAATAACAAGAATTTGGGTGCATTTTCAGGGCC
AATAATGAGAAATCCAAATCAATAGTCACGATCCAAAACA
AATACTGAAATGATTGTAGTGTTCCTTCGCTTTACTTTCA
TTCCTACTGAAATGATATGCACTGTGAAATGATATAAGAA
AAGAAAGGTTTGTTTAGGAGGTTGAATTTCTGATGAATCG
CTGTAAATAGTTTAATATACAAATGGTACGTTTTGTTCTC
ATTCATCTCAAGTTCTGATATCACTGCATATGGAGGTTAG
TCTCTGAGTCTTCTTTGGACTTTATTTGGTGCATTTAAGC
ATTAAAACCAACCTTGATCATCAATCAATCTCATACTTAC
CTCTACTAACTCCTACCGGATGAAACCAGGGCCTAAAACT
AAATTGCTGTTGTTTAGTATATGATACTAATGGTATTAAT
AATGGCTGAGAAAGCAATATGGTTCAGTATGATTATGAAA
ACTTTACAGAAAACTAGTATTCAGTATTTTGAAGCAGCTT
GCTGTGTATTTGAAAAGGCAAACATTTTCCCAGGTTTAGA
TTGAAAATAGTTCATAAATGGGCTGCCAATAAAACAGAAT
CCTTTCAAAATAGTAGTAATCTCCTCCAAAATAAAAGCTT
TGTTGTTTAACTTAAAAGCTAATAAAATAATCTATATAAA
ATCAAACGATAATAATTGCAATGACATGTTTTGCCTCTAT
TTACCTCAATTATGCATTGCTTTTGGGCCAGTAAAATATT
TATTGTATTGTGATAGATTTTCTCAAATGTTTTTGCTTAG
TTTTAGGCCCTGGACACAGAAGTATTCAGTGTAGATTTGC
AGTGCTTGGTAAACCAGTATATTGAATGTTGGCAAGAAAG
TTCTGTCTTGTGTTCTATCTTATTTGTATAAAATCTTTTT
TACGAGATTGAGTTTGCTCAAATATCTTTTAAATATTCCA
ATTTTCTTTTCTTTCCATGTTTTTACTTTATCGAAAGTAA
CCAATAAGATTTGAAAAATGGCAGTATGTTTGGGATTGTA
CATCTTATTTAATTCGAGGTTCCTGTTTTATTCTTTGTAA
CCTCAAATGTAACCTTTTTGGAAGTCATTGCAATTTTTGT
ATATTCTCAAGGTGTTGATTATCCTGGTCATACTTGTCTG
GCTCAGGTATTTTTATTTTGTTTTTTAAGGATGAAAAAAA
AAAACTGAAATATTTTCCATTTGACTATATTTTCTCCTCA
AGGACTGTTACATAGTTTAGGAAACGAATGGAACAAATCG
ATTTATGTAACTTTAAAAGTAAAAATTATTAGCATGGACT
ACATGTAGATATAGGCAAATTATGATATTGCACAGCACAT
ACACAGTTATTTCAAATTAAATTATATAATTTAGTTTTCC
TGAAAATTTGTTGCTAGGGTCAATGATTATGAGGTTTGGC
TTTTATGTTATCTGGGATTAAATAAGAAAGAAAGAAAAAA
ACAAAAAAACAAAGTAGTACCCAACTATATGTATATGTTT
GACAAACAAATTCTGACCAGAAATGAGAAATTTTACACTG
TTTATGAACTTCTCACACTCCAAAGATGTATTTTTTAGCC
ATCTCTTCAGAAATACTTGAATATTCCACAGCTGGTTGGC
TTGTCATCTTTTTTTTTATTTTTTTTTTCCATTGTCTGTG
GCACAGTGTATTTAGACCTCCTAGTGAATGTGTTGGTGTA
GAACACATGGAGATGGCCATGACTCTTCCCTCTGCACACA
TTATCAGGATATTTTATTTGATCAATTGTTCTTGCTACTA
AACGAAAATGTGTGGAAATGAAACCACGGCTAAACTTGAA
TGTGTGATTGATGGCAGAGAATTGTGCGTCATCATTTAAA
AGGAAGTCAATTAATGTACACGCTTAAGGTTAAGTATACA
CTTGGGTATATATATATAATAAATCTTTTTTTTTTGTTAT
AATGAAGGGTTCTATTTAAATTTTGGTTTGCAAGATGTAA
GAAGTAATAAGAGATTTTTTTTCTTTCATTGAGTTTTTTG
GTATGTATACAAATTATGTAACTTGTGCCTGTTAATTTTA
AGAATAAAAATACAGGTTTT

flj11011l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA flj11011l-201 2940
flj11011l-202 (1)    Ensembl 825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
flj11011l-201 Contained in:
[BAC] DKEYP-28D2 (1)

Genome Resources: Vega_Trans:OTTDART00000044414 (1),  Ensembl_Trans:ENSDART00000126842 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC139652 (1) 2050 nt
GenBank:BC116563 (1) 1770 nt
GenBank:AY398346 (1) 1467 nt
GenBank:BC162614 (1) 1232 nt
CITATIONS (2)