ZFIN ID: ZDB-TSCRIPT-091110-46
Transcript Name: tsc1b-201
Previous Names: tsc1b-001, ch211-196o18.2-001, ch211-266d19.2-002, ottdart00000030689

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030689 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030689|OTTDARG00000023532|ZDB-GENE-030131-3404 tsc1b|OTTDARP00000024990 CH211-196O18.2-001 LG_ BX088716.7 Danio rerio protein_coding NOVEL, 5515 bp
GGCGGCGCCCTGTGGAGTGCAGTTTCTCTAACAGTGGTGC
CTGGGGACTGTTTCGACGGGAGGCCCAGGGACCCCTCCAG
GCTGGACAGGACACGGGACGCTGTGAGCGTGACGTCTGAG
AGACTGTTTAAGAGACCCTCCACACCGTCATGTCCAGGGA
ACAGCTGAACGTGGGGGATCTTCTTCCCCTGTTGGAGACC
TCTGACCTCCGCCAGCTGAACGAGATCAAGGGCCTTATTA
ATGAACACCTCAACACAGATCGAGGGTCCGTGCTGCTGAA
TGGTTTGGTGGATTATTTCCTGGAGACCAACTCTGCCCAG
ACAGTGCACATCCTGTCTTCAGTGAGGGAGCCACATGATA
AGCACCTTTTTGATAAAATGAATGAATGCATGGCTAAAGC
CCCCTGTCGCCTGCCCACCCTCACTCTCCTGGGGCATGTT
GTCCGTAAGCAGCCATCTTGGATCCACAAGATCGCGCACT
ATCCGCTGCTGCTATCTCTCCTCAAATGCCTCAAGACAGA
CACAGATGTTGTGGTTCTGATAACTGGAGTCCTGGTGCTC
ATCACACTTTTACCCATGATTCCTCAAGCTGGCAAGCAAC
ATCTCTATGAGTTTTTTGATATCTTTGGACGTCTGGCGTC
TTGGAACCTAAGAAACCCAGGACATGTACCAGAGGTTTAT
CTCATCCATCTGCACGCAAGCGTTTATTCACTTTTCCACC
GGCTGTATGGGATGTACCCCTGCAATTTTGTTTCATACCT
TCGCTCCCATTACAGTATGAAGGAGAACATGGATACTTTT
GAGGAGGTGGTCAAGCCCATGCTTGAACATGTCAGAATAC
ATCCTGAATTAGTGACCGGAACCAAGGACCAAGAGCTTGA
CCCCAGCCGGTGGAAGAGATTCGAAATCCACGATATAGTT
ATCGAGTGTGCCAAAGTCTCTCTGGACCCAAAAGAGGCGT
CCTGTGAAGAGGGCTATGCCAGCATGCCTGAGCATTTCTG
TGCTCATCTACAACAACGTCCGGCTGATTGCACTGCCAGT
CCGTATGGTGACTTCCACAGTAGCTACGGAAGTTCTTCTT
CGACTCATTTCTCCACCCCTCGTCAGCCTGTCGTCCCTCC
CTTGGCCTTGTCCTCTATCTCAGGGACTCAGCCCCCCTAC
CGCAGCCCCACTGGAACCCGTCGGCAGAACTCCAGCTGTG
AATTTAATGCCACATATGGGGTTAAGGATTCTCTCTGGAG
CCCCTCCTCCCAGTGTGGGATGGCCACTCCCCCTTCCTCC
CGTGGGATGTCACCAAACCCGGAACTGTCCCAGAGTGCCT
CTCACCTACCGAGCCGCCTCTACAGCACACCTGCAGGTGG
AAAAGGCACCCCGTCCTCCAGCACGCCTGCAGCTGCAACA
CCTCCTCCTAGTCTATCAGATGAGTATCCCCCTGTATCGA
CGCCACGCAGCACCGCCAGCCCACCATGCAAGGATGGTAG
ACCTTTAGACCATATTAAACCGGTCTTGGTCAGACAAGAG
CAACTCAGAGAGTCTGAAAAAACTGGGCCTGAAACGATGA
ATCACAGAGATGGCAGAGGTGAAAACATGCCCATGACCCT
GACTGAGCTCTCTGTGTACATGAAGGAGCAAGAACAACTG
AGGATCGAGAAGGAGAGGGAGGATGCTGCCATCACAGAGG
AGCTCCTGAAGTTAACCGAGGAGAAGCGGGATCTAGCCGG
CCTCCGTGGCTTCGACTCTCCATTCTTCAGCACTACAGAG
ACCCTGACTGGAGCACAACAGAAACCCCTGCCCTCCTCTA
TTCTTCACAACACCATCTCCACCCCTGACAAAACTGAAAT
AACACCCAGTGACAAAGGAAGAGTCAGCAGAGGCCCATCC
CAAGAGCAACCCTGGTCCTTCCAGCCAGTGTTCATGCCCA
TCGAACACCCGACGCACAGCCTCCTTCATCGGAGCCCGTC
AGCACCAGATGACGAGGCCTTAAAATTTGGCTTGTGTTCC
CCGAGCCCATGCAAACCTCCACCCATGCCATACGAGGCTC
TGTTTGACATGGCTCTGCCTCGGGCTGCCTCTCTTTTTGT
GGGAAGGAAGACTTCAGAGATTGTGCAGCGAGTGGCGATG
GAGAGGTTTCAGAGAGGGGATTCTGGCAGGCAAGGGGAGG
ACGAGGGTGTGGAGGGGGTCGCCTCTGCTTCGCCTCTGGA
GGTGCTGGATCGCCTCGTGCAGCAGGGTGGAGACGCCCAT
GACAAAGTGCTAAAGAGACTGCCCCTGCCAAGCAAGTCAG
CTGACTGGACACACTTTGGAGGTTCAGCTCCTCTGGATGA
GTTGCACACACTGCGCAGTCAGCTTCTGCTTCTACACAAC
CAGCTCCTGTATGAGCGCTATAAGCGAGAGCAGCACGCCG
TTCGCAACCGACGTCTGCTTAGGCGAATCATCAACGCCAC
TGCACTCGAGGAGCAGAATAATGCTATGAAGGACCAGCTG
AACCTGCAAAGTGTGGACATCTTGTCTTTGAGAGAGAGCC
TTCAGGTGGAGCAGCAGAGATACCGGCAGCTCTGGGACGA
CCGAGAGACTGTAGTTACACGCCTGCACAGCCAGATACGA
CAACTGCAGCAAGCCAGGGATGACTACTACACTAAAAACC
AGGAGTTACAGAGCAAGCTTCAAGAATGCCAGAAGCGAAT
AGGAGAGATGGAGGCGGAGCTTCAGAAGGCCAATAATGAG
GTGTGCCACACAGGACACCTGCTGAACCAGCTTACTGCCA
AGTTGTCCTCTAGTGAAAGTATTCAGCAGCAGTTGAGTTT
TCTGAATAAGCAGCTGTTGCTGTTGGGAGAAGCCCATAAA
CTGTGTGTTCAGGAGCTTCATCAGGCTGGACCGGATACTA
GCAAGGAGGTGCAGATGTTGCAGACGTCTTGGGGGAAGGA
GACGGAGCGTCTGAAACAGAATCTGTTACTTCAGAGCCAA
AAGCTGGACGCGGCTCAGCAGAGAGTGGCGGAGCTGGAGA
CTCAGCTCTCTAAGAAGGAGCACCTGATCGCAGAACAAAA
GAAGTTTTTGGAAGATGTCAAGGCTCAGGCTAAAGGGGAG
CTGCAAGCTTCTGAGAGCAGGTATCAGGCACAGAGGAGAG
TGACTCTGGCTCTGCAGACTGAGCTTCTGCAGCTCTATAG
CAGGCTGGAAACAGAAGATTCTTCTGCTGCTGATTCGGCC
TTACAGGCAGAGGGTGTTACTGAGCCTTGCATTACCACTG
AGCCCAGTGTCATAGTAGTCGGCGGTGCCATCAAAACAGC
CACAAAAGAGGACGGAAAGCCACATCAGTCTCCACGTGGC
TATGGCAGCACTTTATCACCAGGCCATCCCAAAGCCAGCT
CTTCTCCGGACAACTCGGTGAACGGCAATCGAGACACTCC
CCCGCCTGTCCTGGTGGAACCACCCCCTCACCGTCCCCAT
TCCCCCCTGGGACCCCCTGGACCCCTGGTGTCGTCTGACA
CCCCACTCACCGTAGGCTCCTACCCCAGCGCCAAGAGCTT
TCTGGGCATGCGGGCACGAGAGTTATTCCGCAACAAAAGC
GAAAGCCAGTGTGACGAGGAAGAAACTCCGCCTCCTCGTC
TAACTGGCCTATCACAGGGCCTGAAAACTGAGCTCTGCAC
AGAGACGACAGCAAAGCGTCCGTCCGTCTCCACCACCGCA
CAAAGCGTCACGCTTATCACATCTGGTAAAGAGTCCCAAC
CCGACGCACAGAGAGCCAAAAAACAAGACACGTTAGGTTC
AAGATGCCCAGAGCGACCCAGGCAGCAACCGTTGAGAATC
ATGGACTATAACGAAAGTCGTCATGAGCATAGCTAAAGTT
ATGGAAAACGGCGAGAGAGAGAATGAAGAAATGTGCGGAT
TTAGATTCATAGAGCGTAAGGCAAGACTCTTTCAATCTTC
AGTGTTATCTGTCCCATTTCCACAAGCCGACAACAGGATT
TGGAGCCAATATATTAGTCAAACCCTCACTAAAACCGGAC
AAGTGGAAGGAATGGACTAATGTGTTGTGTAAAGAGGTGT
TTTTTTTAAGTAACTCCACTGCTTTCTTTATCAGAAGTGT
CTCCGCTGCATCTTTTATTTTATTTAGCTAATTTATCTGC
TCCATTTTACCAAGTAACTGTTACAGCTTTACATTTAGTG
TGTTTAGAAGCAATATAAGTCCATTCAGTCTTAGGAAAGG
TTCAAAACTTCAACCTTCACAACTCACCTGCGCAGAGCAA
GAACAGAAGTGTTTGCTTGGATACCAGGAGTAGGAGGTTT
GATGGTCATCTTATGCCAAGCAGAAGTCAGTGTTTCTTTA
AAAACCTTTTAAACATGTCAAGTGCATTTTCATGAGCTCA
AACTATGTTTATCTTTATTGTGTTACTGTATGTATGAGTG
TGTGTATGTGTGTGATGTATGTTTGTGTCCGAGTTGAAAG
CGATGACCTGTATCCCAGATTTATTTCTGGGTTAAATTGC
ACTCATTTCTTACTCATTTACAGAAAAAAAGAAAATCTAC
AGTAGTCTTGGATTATACTAAATCGGGAGAAATAAATGAG
AGGAAGCCAAAAGAGAGGAAGGTTAGACATGTTTTTTAAA
TTATTTATTTTTTTGTCTTCTCCTCATTTCTAGCTTTTTA
ATTATTACCAGTCACTCGCCAGGGCTTTTAAAACTTACCA
AAACATCATAATCCTAAACAACGGCTGCAAATTTGTGATC
ACTACCCACAAAAACCTAATCTGTAATCTCAGAAAGAAAC
TCTAGTGGCCATTTTGAAGTCCTATTCTAACATTCGATTC
AAATGAAGTACTTCGCTTTGACGATACTAACCTTCAATCT
AAATCTAAGTCATTATATTCGCTTGGATAATTGATAATAG
TATGAATGATCTGCCGTTTACCCTCTCACTTTAGAGTATA
TTATTACTTATTTTGCTTTCTGAGTGCCAAATACTCAATC
CGTAACACGATAATAGTATTCTGTAGAACTTAAATGTATT
GGTTTCCGTTGTATTATTCACTCGACTGTTCTTATGCTAC
CACATATCAATTTGAGGGGGTAAATACAAGATCTGTACAT
TGATAATTGGTTGTGAGCTGTACGATACCAAGTTGGCGAT
TTTTGGCCATACCAAGTAGGCGATATTGAGTGGCCATGTT
AATCGTCATTTAGGAATTGCGGACATGGTGGTTATAAAAC
TGTACCCAAATCCTGTTGTCCCCTCAGTCTCTGCTGTTCC
TTCTGCCTTGCTATCTAGAGCATGTACAACAATCCTCTTT
TAATGCCAACGACAGGAACCACGACGTAACAAGACACAAG
GTACAATCATCGTGAAAGGAAAAGAACGTTTGAATTTGAG
CTCCTTTGCTGGAGGTGAAAGTTCTGGGGTTTGTCGAGGG
ATAAAAAAAAAAAAAAAACGAAAGGCCGGGTCGAGTGGAA
AATGTTCTTAAAAGCAGTTGCTTGTGTTAACTGTGAATGA
CAAAAATAAAATCGTCTTCAATGTTTTGCACTACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tsc1b-201 Contained in:
[BAC] CH211-196O18 (1)

Genome Resources: Vega_Trans:OTTDART00000030689 (1),  Ensembl_Trans:ENSDART00000145057 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG568282 (1) 953 nt
GenBank:CF997285 (1) 829 nt
GenBank:CT604993 (1) 816 nt
GenBank:DT070210 (1) 767 nt
GenBank:DR715696 (1) 712 nt
GenBank:CT604994 (1) 678 nt
GenBank:EB930676 (1) 606 nt
GenBank:EB923471 (1) 392 nt
GenBank:EB930786 (1) 367 nt
CITATIONS (2)