ZFIN ID: ZDB-TSCRIPT-091110-429
Transcript Name: yipf5-201
Previous Names: yipf5-001, ch211-13l22.1-001, dkey-83d6.4-001, ottdart00000044121

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044121 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044121|OTTDARG00000031671|ZDB-GENE-040426-1057 yipf5|OTTDARP00000034942 DKEY-83D6.4-001 LG_ CU302322.12 Danio rerio protein_coding NOVEL, 1430 bp
ATCTTATTTATTCCAACGACCCGGAAGTTCTTCTGCTATT
TTTTGACACGTAGTTAGCGGTGTTGGCGGAGTCCTGGACC
ATTAGCGGTGCAACTTGCAATGTCAGGATTTGACAACTTC
AACACAGACTTTTATCAGTCTAGTTACAGTGTAGATGATC
AGAACCAAGGAGGATATGGCTACAGCAACACAGATGAGCC
CTACAAACCATATGGACAGTATGATTACTCACAGCCAATG
GGCTACTCGGCAGCTCCAGGAATGATGCAGCCACAACAGC
CATACACTGGACAGATATACCAGCCCACACCAGCCTTTAC
CCCAACCTCCTCACAATCCATGTACAGCAGCAGCTTTGAA
GATGAGCCCCCGTTGTTAGAGGAACTGGGAATTAACTTTG
ACCACATCTGGCAGAAAACGCTGACTGTGCTGCACCCGTT
GAAAGCATCAGATGGAAGTATAATGAATGAAACCGATCTG
GCTGGTCCCATGGTGTTCTGTTTGGCGTTTGGGGCAACGC
TGCTCCTGACAGGTAAGATCCAGTTTGGTTATGTGTATGG
CATCAGTGCTATTGGATGTCTGGGCATGTACTGCCTCCTC
AACCTCATGAGCATGACTGGGGTCTCGTTTGGCTGTGTGG
CTAGTGTTCTGGGCTACTGTCTGCTACCCATGATCATCCT
GTCCAGCTTCGGGGTTATCTTTTCCTTACAGGGCATAATG
GGTATCATTTTAACTGCCGCCATCATTGGTTGGTGCAGTC
TTTCAGCCTCCAAGATCTTTATCTCTGCCTTGGCGATGGA
TGGGCAGCAGCTGCTGGTGGCCTATCCCTGCGCCCTGCTC
TATGGAGTCTTTGCCCTCATTTCTGTCTTTTGAACTCTTA
TCCTCTTTTAATGGACAAAACGACCACCACCACTCTCACA
AACCTTTATTTGAGGACTGCTTTTTGTGAACACAACATAA
GGAGTTTCTTAGAGAATGTGGAATTATTATGGTTTGTTCT
CACCTGCCCACGTCCTCTAAGAAATTATCTTGCTTATGAT
GCAGGTTAAAATGTGTTCTGTAGTTCTTTGCAAAATCAGT
TCCTTTACCATAGTGAAAGTTAAGCGTTTATGGGAGAGAA
TATATATATATATAATTAATGCAAATGTCATCTCTCCAAC
ACAACACTGGTGTTAAGTTTGCAATGTTCATATGCACAGT
ACACCAGTTTTTTTTTTGTCGTCATTTAATTATTTTTCTT
TACATTCCTGAATTACTGTTGATTTGCTCAGCCTGTGTTT
ATTTATACATTTGAGTCAGTATAAGTAACTAATTTTCACC
ATTTTTTTATGTACCAGGAAAATTAAATGGGACTGTAAAA
AAGCTAGTTTGAACCAATTTAAAAGAATTTGTCACACCAA
AATAAAGATGCTGTCATTTACTTAACCCCA

yipf5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA yipf5-201 1430
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
yipf5-201 Contained in:
[BAC] DKEY-83D6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000044121 (1),  Ensembl_Trans:ENSDART00000008593 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049469 (1) 1424 nt
GenBank:BC062871 (1) 1381 nt
GenBank:EH565782 (1) 930 nt
GenBank:EH494202 (1) 902 nt
GenBank:DN765382 (1) 790 nt
GenBank:EV755651 (1) 694 nt
GenBank:AI588595 (1) 532 nt
CITATIONS (2)