header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-423
Transcript Name: csf1rb-202
Previous Names: csf1rb-001, ch1073-309n14.1-001, ch1073-368i11.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044106 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044106|OTTDARG00000031660|ZDB-GENE-091118-1 csf1rb|OTTDARP00000034931 CH1073-368I11.1-001 LG_none CU695196.4,CU694443.4 Danio rerio protein_coding NOVEL, 2894 bp
TCCCCCCCTTTCCACCCCTACATCCTCCCACTTTTTCTGA
TCGGGCGACACGGTGGCCCAAGTTTGCGGCACCGGTGATA
AAGCTGAACGGGACTCCGCTGAAGGACTCGGAGGTGGTTT
TGTCAGCAAACACATCCTTCGTTCTGCACTGCGACGGACA
GGCGGAGATCATATGGAAGACCAGGCGCAGAATACACCAG
AAAAACCTCTCACAGAACGAGCTGGTCGTCCAAAAAGCCA
CTGCAGAGCACACGGGAACATACCGCTGCAGCTACAGGAG
CCACACAGACATCTACTCAGAGATCCACTTATATGTGAAA
GATCCCGACAAAGCCTTTACTACGTCTCAAACCCGAGTTA
TAGTCATAAAAGAAGGCTCGAGCTTCTTGCTGGACTGCTT
GCTGACAAATCCAGCAGGGACAGAGTTTTCGCTCCAGATG
ACAAACGGATCCGCTGTTCCTCCTGGGATGAATTATACTG
CGGATCCCAGACGCGGCATACTGATACCAAACCTTCAGCC
GAGCTACACCGGAGATTACGTCTGTATGGTGAACATGAGC
GGAGTCCAATGGAAATCAAAAGTCTTCCAAATCACCGTCA
TAAAAAAAGCACAGGAGCCTCCATCAGTGTCTCTTCCAGC
TCTACAGTATGTGCGGATTGTTGGAGAATCACTGCAAATC
CCCTGTTACATCCAAAACCATAATCATTACTACAACTTCA
CCTGGAGCTCACCAAAAAAGGTTTTGAACTTTGAAAGAGA
GATAAAGAAAAAGAAAAAGTGTGAACAAGTTTGTGCCACT
ATATATTTGACCTTTCAACAATTAAAGATGTCCGACACGG
AGAATTTAACCTGCACTGCCATGAACGAGGCTGGAAGAAA
CAGCAGCACAGCAGTTCTTAGAGTTGTAGAAAAACCTTAC
CTGGAACTCACACCCATCCTGTCCTCTGAATACAAGGGGA
ACGAAACGAATGTTGTGCGCATGCATGGAGATCAGCTTGA
GCTCGGTGTGCACATCCAAGCATATCCAGATGTTGAATGG
GCTAAATGGAAAACTCCAAGTTCAAATCACAGCTATGAGG
AGACATTTCACAAGATTCACGACAGTGATATCTACATGGC
CACAATCCGGCTCAAAAATGTTGGAGCACAAGACTACGGT
GACTACATCTTCAGCGCCGGCAGCACCAGTGTCAATGCCT
CCATTATTTTCACAGTACACGTCTACCAGAAGCCAACAAC
AGTTATTAAGTGGGAAAATGGAGTCGTCAGTTGCGCAGCG
ACTGGCTACCCCATACCTAGCATCCAGTGGTTCCAGTATG
AAGTTAACAGAGCTTTGTGTAGTGACAACCGTACATCAGG
TGTGGAATTAATGGCCAACCAATCCATTTCTGAGCAAAGC
GGAGAGTATGAACCAGTGCTGGTGAAGAGTGCATTACCAG
AGATTACAGCTAATGCTGATTTAATATTTGAGTGTGTGGC
AACAAACACCGCTGGAGACGATTGTGACTTCTATACCTTT
ACATTTTCAGGTCCTCGCCCTACATCGGTGTGGTCAACTT
CAGTGCTAATCAGTCTTGGTCTCTCTGGAGCTCTCTCTGT
GGCAACTCTATGGATGTTAATTCTCCTCTACAAGAACAGA
AAGGCACAGAAGTATGAGATTCAATGGAAAATCATTGAGG
TAAATGATGGGAACAACTACACATTCATTGACCCCAGCCA
ACTTCCATACAACAAGAAACTGGAGTTTCCTCGAAATAAG
CTGAAGCTTGGACAGGTTCTTGGAGCAGGAGCGTTTGGGA
AGGTGGTGCAAGCAACTGCTATTGGCCTGGTCAAGGATGA
AACCATCACACGAGTGGCGGTGAAAATGCTCAAGCCTAGC
GCCCGCTTTGAAGAAAGAGAAGCACTCATGTCTGAACTGA
AGATCTTAAACTATATTGGACCACATGAAAACATAGTCAA
TCTGCTGGGGGCATGCACTCAGGGCGGACCCATGCTGATG
ATCACTGAGTACTGTTGCCATGGCGACCTCCTCAACTTCT
TGCGCCAACGAGTAGAAACCTTTGTGAACACTGTTCTTGG
TGTTCAGAGTTTTGCCGAAGACTCAAACCTCTACAAAAAT
GTGACCATCCAAAAGCAACATCCCGCAAGGAATGCTTACT
CTGGTTTAGACAGCTTTAGGGACACACCGTCAGGACAGAT
GCCAAAAGAGCCTTTTCAGGAGTCCTGTAATGAAGAATTG
GAGAACATGCTGTCATTGGATAACATGGATTTGCTTATGT
TCTCATATCAAGTGGCTCAGGGAATGGACTTCCTGGCTTC
CAAAAATTGTATTCACAGAGATTTGGCAGCACGGAACGTT
CTAGTGGCTGACTGCCGCATTGTCAAGATCTGTGATTTCG
GTCTTGCTAGAGACATCATGAACGACACCAATTATGTAGT
AAAAGGCAATGCACGGCTGCCAGTGAAATGGATGTCACCT
GAAAGCATTTTTGAATGTCTGTACACAGTCCAAAGTGATG
TCTGGTCATATGGTGTCCTTTTATGGGAGATTTTTTCCTT
GGGTATGAGTCCTTACCCCAATGTTGCGATTGATGCCCAG
TTCTACAAGATGATAAAAGACGGTTATCACATGCCACAAC
CAGATTTTGCGCCACATGAAATGTACACTATCATGAAAAT
GTGCTGGAGACAGGAACCAACTACACGGCCAACCTTTGCT
GACATCACAGAACTCATTGCAAAGTTACTGCCAATGCAAA
CCAGTGAGGACAATGAAACCATGTATCCAGAACTTCGAAG
GCACCTGATGGCAAACCATTGCAACACATCACCAGTCTGC
ACTGATCAAGCCGGCAGTGAAGAGGCTCAGCCTTTAATGA
GGAGCACAACCTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csf1rb-202 Contained in:

OTHER csf1rb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044106 (1)
  • Ensembl_Trans:ENSDART00000142718 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (2)