ZFIN ID: ZDB-TSCRIPT-091110-386
Transcript Name: lifrb-202
Previous Names: lifrb-001, dkey-120e24.3-001, dkey-229d11.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043969 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043969|OTTDARG00000031579|ZDB-GENE-091204-247 si:dkey-120e24.3|OTTDARP00000034846 DKEY-120E24.3-001 LG_ CT827810.6 Danio rerio protein_coding NOVEL, 3101 bp
GAGAGTTTGCCTGTTGCTCGCTAAAGTTAGCTTGTGAAAA
TTTAATATTTTTACCTGAGAGCGAAAATAATTGAAGGTCA
ACCACAGTGGATTCATCGACATACAACAAGGCTGTCAACA
TTTCAAACAGGCTTAATTGCTAATGGAGACACGGGTGAGC
CATTACTGGTGCAGAAGCTTCTGAACTCTGTCATGTCGGT
CTGGCTATTGAGTGCTTTGCTTGTGTCTCTGATTGAGCTG
GCAGAACAGGATGGGCTTCCACTTTCTATAAGGGACGTAA
AAGTATCTGAAGAGAAAACGGAAACATCTAAGGATGGAGC
ATGGGTGTTGAATGTTGAATGGACAGATGAAAATAATGAA
TTTGAAAAAGTCAGCTATGACATAGAGATCATTCACACTG
AACAGATGAGGACCGTTCACTTTGAAAATATACATGTGAA
GGCAGACAAAAGCAGCCATTATCATTGGAAATGGACCTCA
CCTATACCATTGCAGTGCACTTCTCATTCGGTCAGACTTA
GGCGCCGAGATCAGCTTCGCATTAGTGAATGGACATCATA
TTTGACATACACAGGTCAAGACCAAAATTCTTTGACTTCA
CAAGTCTATCCTCGAAATCAAGTTTTCTTGATTGGGAGTA
ACATCACATTTTGTTGCATCTTGAAAACAGAAAAGGCTTC
ACTGAACAATCTCTCTAAATTTGTCATCCGCATCAGCAAC
AGGACCTACATCACAGAGACCCACAAGGATCCCTTTTCCA
GAACTTCTGAATATTTTTCAGACGTCGACTGTGAAGTAAA
AAATGAAAAATCTTCTTCTGGCGCATCAGTATTTTTTGGC
TATCCTCCAGATGACCAGAATCTTACATGTATCACACGAG
ACCTCAGCTCTGTGGAGTGTCAGTGGAAACTTGGCAGAAA
AACCCAGCTGTATGGTACAAGAGCTACAAACTACACACTT
AATGGAAGAAAATGTGAATTCAATCGATGTGACCCACTTG
AGCTGAAAAAGCAGATTACAAACTGGACTCTGATTGCCAG
AAATGCACTTGGTGTGAAGATTGTCACTGATACAGGTGAT
CCCACACACCGAGTATGGTTGAAAGCACCTCATAATATAT
CCCATGCTGCTCATGCAAGAAATGCCACTGTTCACTGGAG
TTGGAGTGTAACAGAATATGCTTCACTTCTAATGATTTGC
CAAAAAACCTTTAGTGGAAAAGGACTTGCGTCAGTTGTGC
TTGAGCATCTGCAGCCCTTTACTAAATACACAGCTAAAGT
GAGTTGTGGGTCTCATGAGCATTTCTTCCAATGGGGTGAC
TGGAGTGAAATTACTTTTACCACTAAAGAGGACATTCCAG
AACTGGTAGATGTTTGGATTCAATATTCTGAAAACCACAC
ATATATTCAATGGAAGCCTCTGTCTCATCAACAAAGCCAT
GGGATAATAACAGGTTATAAACTAACCATGAATACCATCA
AAAGTCCAGTCAATATAGGAGCAAATGAGCTGTGCTACAG
TATCGCCTCTGAAAATGAAAAAAATAATCAAATAATCAAA
TTGTCAGCAAAAAACTCTGCCGGTCTTTCTCCTCCTTCTG
TCTTAATCGTCCCACATGATCCTGGCAAAGGAGTCAGTAT
AAGCCTTATCAACAGCACTAATGGTGGATTTGAGGTGTTT
TGGAAAATGTATCCCAAATCAACTTGTGGCTATGTTGTTG
AATGGTTTCCAACCTACAATAAGACACAATGTGCTGTAGA
TTGGAAGAAAATCCCAGAATGTGATGAGGATGTGTGCCAA
ACTTGGATTCCTCCTGTTGAATTTAAGGCCGGAGAGAGAT
ATACTATCTCAGTCTTTGCCTGCACTAATGGAGCACCAGT
GCTTCTGCAGAGGAGTGAGGGATACGCTATAGAGCAAGAA
CCACAGGGTACAGTACAGAATCTACACGGTCAACAAAATG
GCAGAAATGTTGAGCTTTCCTGGAAGGAAGTGGCCTTAGA
CCAGCAAAAAGGCATCATACTTGGCTACAAGGTCAAAATA
ACCCATTCTGAATCCAAAAAGGTCATCAAAACAATAGAGA
CAAAGGCGTGTGAAGTTATTCTGCCATTAGATCCAGGATC
CTACATCTTCACAGTTCGTGCTTTTACATCAGTAGGGGAA
AGCGAAGATGCTATACTGACAATGAATGTAGAAACAACAA
TTGACCAGATGCTTGCAGCCACTCTTGTTGGTTGCAGTGC
AGCAACTCTTGTCTTCATCATCATCACAGTGCTGTGCTAC
AGGAAGAGGGAATGGTTAAAGGACCTTTTGTATCCAGATA
TTCCTGAACCAAAACTAGCAGGGAAATGGACTACACAGGG
CATATATTGTACCCAGATGACCGAGGGATACGTGAAGTGT
GAGATTCAAGAGGTTCACGGCTCAGATCATCCCACCTCAG
AAAACCCACATGGCCTTGACCACCACTGCTCTAAAAAGCC
ACTGTTTCCTGCACAACCGTTGTACTACAATACTACTTTT
CCTTGTGCTAAGAAGCTTACCTCGATTATTGAAAACCCGT
CTTATAATTTGACCACCCCAGGACCAGTCGATGTTGTGCA
GACGTCTAAGCCTCTTTTGGAAATGCAGGATAGTTACCTT
CCAGCAAGTAAGTTTGCACAACCAGTATGTCACTCTGAGC
AGGATAGTTACCTTCCGGCGCCTAAATTTGTGCAACCACT
TCCCATTGCTGTGGAAGATACTTACATTTTTGCGCCTACA
TCTGGGAAAACAACCCCTATCCATGTGGAGGATACTTACC
TTCCAGCTCCTAAATTTGGGCAGGCACCCTCTATCCATGT
GGAGGATATTCACCTTCCAGCTCCTAAATCTGTGCAGCAA
TTCTCTATCCTTGTGGAGGACACTTACCTTCCAGCTCCTA
AATTTGTGCAACCATCCAATAACCTTGTGCAGGATAGTTA
TCTTCCAGCACCTAAATTTATACAACCTAACTTTGCACAG
AATAATGTAATTGATAAAAACACAGCAGGCAAGCCTCAGT
CTGCATGACCACAAAAAAACACTGCGCATTTATGAAGCGA
GCTTCACACAGGTGAGTGGGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lifrb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043969 (1),  Ensembl_Trans:ENSDART00000131890 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA471105 (1) 896 bp
GenBank:CK239131 (1) 790 bp
GenBank:CF348027 (1) 755 bp
GenBank:EB861873 (1) 462 bp
CITATIONS (2)