Transcript

notch1a-202

ID
ZDB-TSCRIPT-091110-240
Name
notch1a-202
Previous Names
  • notch1a-001
  • dkey-17e16.15-001
  • ottdart00000043428
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043428 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043428|OTTDARG00000031225|ZDB-GENE-990415-173 notch1a|OTTDARP00000034432 notch1a-001 LG_none 1 CR388125.8,CU611035.9,CABZ01041310.1,CABZ01041309.1,CABZ01041308.1,CABZ01041307.1,FP102164.3,FQ790227.4,CU694955.15 Danio rerio protein_coding KNOWN, 5848 bp
GGTCCGAACTGCCAGATGAACATTAATGAGTGTGCGTCGA
ACCCGTGTCTGAACCAGGGCTCCTGCATTGACGACGTGGC
TGGATTCAAGTGCAACTGCATGCTGCCGTACACAGGTGAG
GTGTGTGAGAATGTTTTAGCCCCTTGTTCTCCACGTCCCT
GTAAAAACGGCGGTGTGTGTCGTGAATCTGAGGATTTCCA
GAGCTTCTCCTGTAACTGTCCGGCTGGATGGCAAGGTCAA
ACGTGTGAGGTGGACATTAATGAGTGTGTGAGGAACCCGT
GCACTAATGGAGGAGTGTGTGAAAACCTGCGCGGTGGATT
TCAGTGCCGCTGCAATCCTGGATTCACTGGAGCTCTATGT
GAAAACGACATTGACGACTGCGAGCCCAACCCGTGCAGTA
ACGGCGGCGTGTGTCAGGACAGGGTCAATGGTTTTGTGTG
TGTGTGTTTGGCTGGTTTTCGAGGGGAGCGCTGTGCAGAA
GACATTGATGAGTGTGTGAGCGCCCCCTGCAGGAATGGTG
GAAACTGCACAGACTGTGTTAACAGCTATACCTGCAGCTG
CCCTGCGGGCTTCAGTGGCATCAACTGCGAGATCAACACA
CCCGACTGCACCGAGAGCTCGTGTTTTAACGGTGGGACGT
GTGTGGATGGCATCAGCTCGTTCTCCTGCGTGTGTTTGCC
GGGATTTACTGGGAATTACTGTCAGCATGATGTGAACGAG
TGCGACTCTCGGCCATGTCAGAACGGCGGCTCCTGTCAGG
ACGGATACGGCACCTATAAATGCACATGTCCACACGGCTA
CACCGGACTCAACTGCCAGAGTCTAGTGCGCTGGTGTGAC
TCGTCTCCCTGTAAGAACGGAGGCTCGTGTTGGCAGCAGG
GGGCGTCCTTCACCTGTCAGTGTGCCAGCGGCTGGACTGG
CATCTACTGCGACGTGCCTAGTGTCAGCTGTGAGGTCGCT
GCCAGACAGCAAGGTGTGTCTGTGGCAGTTTTGTGTCGTC
ATGCGGGTCAGTGTGTTGATGCAGGAAACACACACCTGTG
CAGGTGTCAGGCTGGATACACCGGCAGTTACTGTCAGGAG
CAGGTGGACGAGTGTCAGCCGAACCCCTGCCAGAATGGAG
CCACGTGCACAGACTATCTGGGAGGATACAGCTGTGAGTG
CGTTCCTGGATATCATGGTATGAACTGCAGCAAGGAGATA
AACGAGTGTCTTTCTCAGCCCTGCCAAAATGGAGGAACCT
GCATCGACCTCGTGAACACCTACAAATGCTCCTGCCCACG
AGGAACACAAGGAGTTCACTGTGAGATTGATATTGATGAC
TGTTCTCCATCTGTGGATCCGTTAACCGGAGAGCCGCGGT
GTTTTAACGGCGGGCGGTGTGTGGATCGTGTCGGTGGTTA
CGGTTGTGTGTGTCCGGCTGGTTTTGTGGGCGAGCGTTGC
GAGGGTGACGTTAACGAGTGCCTGTCAGACCCCTGTGACC
CCAGCGGATCCTACAACTGTGTTCAGCTCATCAACGACTT
CCGCTGCGAGTGCCGTACAGGATACACCGGGAAGCGCTGT
GAGACAGTCTTCAACGGCTGCAAGGACACGCCATGCAAAA
ATGGAGGAACTTGTGCTGTAGCGAGCAACACCAAACACGG
ATACATCTGCAAATGCCAGCCTGGTTACTCCGGCTCATCC
TGCGAGTATGACTCTCAGTCGTGCGGCTCGCTGCGCTGTC
GTAATGGTGCCACCTGTGTCTCCGGGCACCTGAGCCCTCG
CTGTCTGTGTGCACCGGGCTTCAGTGGGCATGAATGCCAA
ACTCGCATGGACTCGCCGTGCCTAGTCAACCCGTGCTACA
ACGGCGGCACCTGCCAGCCAATCAGCGATGCTCCATTTTA
CCGCTGCTCCTGCCCGGCTAACTTCAACGGGCTGCTGTGC
CACATTCTGGACTATTCGTTCAGCGGTGGGCAGGGTCGGG
ATATCGCCCCACCAGTCGAAGTGGAAATCCGTTGCGAAAT
CGCCCAGTGCGAAGGACGCGGCGGAAACGCCATCTGTGAT
ACGCAGTGTAATAATCACGCATGCGGATGGGACGGCGGTG
ACTGCTCTCTGAATTTCGACGACCCCTGGCAGAACTGTAG
CGCCGCCCTGCAGTGCTGGAGGTACTTCAATGATGGGAAA
TGTGACGAGCAGTGCGCCACCGCGGGCTGTCTTTATGACG
GATTTGACTGTCAGCGGCTGGAGGGACAGTGCAATCCTCT
GTATGACCAGTACTGCAGGGATCACTATGCGGACGGTCAC
TGTGATCAGGGCTGTAATAACGCAGAGTGTGAATGGGACG
GTCTGGACTGCGCTGATGACGTCCCGCAGAAGCTGGCGGT
GGGCAGTTTGGTTCTGGTGGTCCACATCCCGCCGGACGAG
CTTCGAAATCGCTCCTCATCGTTCCTCCGCGAGCTCAGCA
GCCTGCTGCACACTAATGTGGTGTTTCGGCGCGACGCCAA
CGGAGAGGCGCTAATCTTCCCGTACTACGGTAGCGAACAC
GAGCTCAGCAAACACAAGCGCTCTGATTGGACAGATCCTG
GTCAGCTGATGCAGCGTGCCAGGAGGAGTCTGACATCATT
TTTGAAGCCCCGCACACGCAGAGAGCTCGACCACATGGAG
GTCAAAGGGTCTATCGTGTATCTGGAGATTGATAACCGTC
AGTGTTTTCAGCAGTCTGATGAGTGTTTTCAGAGCGCGAC
AGATGTGGCCGCTTTCCTCGGAGCTCTGGCCTCCAGTGGA
AACCTCAACGTTCCCTATATCATCGAGGCCGTCACCAGTG
AAGGTGGTCCCCCAAAGACTGGTGAGATGTACCCCATGTT
CCTGGTCCTGCTGGCTCTGGCTGTTCTGGCTCTGGCCGCT
ATCGGTGTGGTCGTCTCCAGGAAGAGGAAGCGGGAACATG
GCCAGCTTTGGTTCCCCGAGGGATTTAAAGTCAACGAACC
CAAAAAGAAGAGGAGAGAACCAGTGGGAGAGGACTCTGTC
GGACTCAAGCCTTTGAAAAACTCAGACAGCTCTCTGATGG
ATGAACAGCTGAGCGAATGGGCTGAAGACGACACCAATAA
ACGATTCCGGTTTGAGGGGCAGAGCATTCTGGAGATGAGC
GGTCAGTTGGATCACCGTCAGTGGACTCAGCAGCATCTGG
ACGCTGCAGACCTGCGCTTGAACTCGATGGCTCCGACGCC
GCCGCAGGGCGAGATCGAAAACGACTGCATGGACGTCAAT
GTCCGCGGGCCTGACGGATTCACTCCACTGATGATCGCAT
CGTGTAGCGGCGGCGGTCTTGAAAATGAAAACGGCGAAGC
AGAAGAAGATCCGTCCGCTGACGTGATCACAGATTTTATT
TATCACGGAGCCAACCTGCACAATCAGACGGACCGCACAG
GCGAGACCGCACTTCATCTGGCAGCACGATACGCTCGCTC
GGATGCTGCTAAACGTCTGCTGGAGTCCTGCGCCGATGCT
AATGTGCAGGATAACATGGGCCGGACACCGCTGCACGCCG
CCGTCGCTGCTGATGCACAGGGAGTCTTCCAGATCCTCAT
TCGGAACCGAGCGACGGATCTAGACGCCCGCATGCATGAT
GGGACGACGCCGCTGATTCTGGCCACCCGATTGGCTGTTG
AGGGAATGGTGGAGGAGCTCATTAACTGCCATGCAGATCC
GAATGCTGTTGATGATTCAGGTAAATCAGCTCTTCACTGG
GCGGCTGCTGTTAATAATGTGGATGCTGCTGTCGTGCTGT
TGAAGAATGGAGCTAATAAAGATCTGCAGAATAATAAGGA
GGAAACGCCTCTTTTCCTCGCTGCTCGTGAGGGAAGTTAC
GAAACGGCTAAAGTCCTGCTTGATCACTTGGCCAATCGGG
ATATTGCAGATCACCTGGACCAGCTGCCCCGGGACATCGC
TCATGAGCGCATGCACCACGATATCGTGCGTCTGTTGGAG
GAATATAACCTTGTCCGAAGCCCCCCGCTACCCTTATCAC
CCCCGCTCTGCTCCCCAAACACATACCTGGGCATCAAACC
CAGCCCAGGAAACAACAACAACACGGCTAAGAAAACACGC
AAACCCGGAGGAAAAGGTGTTGGAGGGAAAGACAGCGGGA
AGGACATCAGAACCAAAAAGAAAAAGAGCGGAGATGGCAA
AAACGGCGGGATTATGGAAGTGGGCGTCCTCTCGCCTGTT
GATTCGCTGGAGTCTCCACACGGCTACCTATCAGACGTCT
CGTCTCCGCCCATGATGACATCACCCTTCCAGCAGTCTCC
GCCCATCAGTTTAAATCAGCTCCAGGGATTGGCCGACTCC
CACATGGGTGGAGCTCTTCAGGGTTTAGGGAAGCCTTTTG
ACTCCGCCCCTCGTTTATCCCATCTGCCGGTGGCCAACAA
TGTGGGTGGAGCTCAAGCAGGCGCTTGTGATTGGCTGCAA
AGGGTGCAGCAGCAGCAGCAACAACAACAACAACAACAGC
AGGCAGGCATGCTAATGCCTACAATGCTCTCTGCTACTAA
TATGCCACAAGTCATGGGCTATCCCACCATGCAAAGCAGC
CATCTTGGTGCACCGTCACACATGATCGCCCATCAAAACA
TGGCGCCAATGCAGCACCAAAACATCTCGCATCACTTCCT
CGGGGACCTCAGTGGGCTGGATCTTCAGTCAAGCTCAGGA
CACGCCCCCATTCAGACCATCCTACCGCAGGACAGCCAGC
GCATGGCTCCGCCTATTTCTAGCACGCAGTTTCTGACTCC
GCCTTCTCAGCATAGCTATTCTAACCCTATGGACAACACA
CCCAATCACCAGCAGGTCCCAGACCACCCGTTCCTCACAC
CCTCCCCCGGGTCTCCCGACCAATGGTCCAGCTCATCTCC
ACATTCCAACTTGTCTGATTGGTCGGAAGGAATCTCGAGC
CCGCCCACCAGTATGCAGATGAACCATATTCCAGAGGCTT
TCAAGTAGGCGGAGCTTCGGCATAAAAAAAAAAGCTAGAC
TGTTTATAATTACCACAAGAACTGTTTTTATGGACTGATT
TTTTTATTATTATTATTATTGTATGCTAAGAACCATTTTT
ATTGTTTTTTTTGTATTTATTTATATGCGTTTGGACTACA
GAAATACATTTCTTTTTAATTTATACTGTATTTTATTTCT
ATTTTAACCATATCCTGAAAATAATTCTTTAAAAAATTGT
GATGCTGCCAGAGAATTTTTTGTTTGTTTGTTTTTTTTTT
TAAGTAAAATTTCAGTATTAATTAGATTTTATATGATCCT
TTTTTACCAAACGGCTAGTTTTCTGAGACAAAAGAGTAGA
GAAAGTCTTAATATTTTGCTGTTTATTGTATAGTGGATGT
ATTGACACACTCTGACTTGCCTCCGCACACATTTCTTTAT
TTTTGTGAAAGAGAGTCATTTATGATGAGTTTATGCTATG
TTACCGAGTATTGTCTGTAGACACTGTTCTCACTTCACTA
AGAGCCCAAATGTTTGTTTATTTCCCATGGTACCTTGCTT
CAGGTGTTTTGGGAGCTTTTCATATGTAGCGTAGCGATCA
CTGTTATTTATTGCCTGCTGTAGACATGTTAGACATTTTT
GAAGACATGTAGATGAGTGTGAGTGAGTGTGTGTGTGTGC
GCGTGTGTGAGGGAGTGTGTGCAGTGTGATGACATCACCG
GTGCTCATAATGGTGTGGCTGTAATGTACCTGTTATGTTT
TATAAATGCAGATCAAATGTTCTACTGATGACATGAAAAT
GACTGATTGTAGTTTGTGGTTTAAAAAATGTTGTTCAATG
CTTTTGTAAAGAACATTTTCTTGACACAATAAAGGATTGT
TACTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations