ZFIN ID: ZDB-TSCRIPT-091110-233
Transcript Name: zbtb16a-202
Previous Names: ncam1-003, zbtb16-001, zbtb16a-001, ottdart00000043392

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043392 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043392|OTTDARG00000031202|ZDB-GENE-030131-1989 zbtb16a|OTTDARP00000034402 zbtb16-001 LG_ CU550732.1 Danio rerio protein_coding KNOWN, 1445 bp
AGTGCGCGTGAGAGAGAGCGGGTACTGTGAACAGCGTTAC
TATGCTACAGTCCTAATAACCGCACGCTCGGAAGCCAAAC
GCGCAACACAGATTGACCTTATCTTGTTTACAAAGATAAC
TGAACAGACTGCTGCGTGGAAAGAAATACTCATGAGTTGG
CCGTGTGGATTTCAGAGACGTTATGGATTTGACTAAAATG
GGAATGATCCAGCTCCAGAACCCCAATCACCCCAATGCCC
TGCTGCACAAGGCTAATCAGATGCGCCTGGCTGGCACGCT
GTGCGACGTGGTCATCATGGTGGACAGCCAGGAGTTCCAC
GCTCACCGCACCGTGCTGGCCTGCACCAGTAAGATGTTCG
AAATCCTCTTTCACCGGAACAGCCAACATTACACTCTTGA
CTTTCTCTCACCAAAGACCTTCCAGCAGATTCTGGAGTAT
GCCTACACTGCCACGCTCCAAGCTAAAGTAGAGGATCTGG
ATGATCTGCTGTACGCAGCAGAGATCTTAGAAATAGAGTA
CTTGGAGGAGCAATGCCTGAAGATTCTGGAGACCATCCAG
TCCTCGGATGAAAATGACACTGAGGTTAACATGAACGATG
GTGGCACAGAAGATGACGAGGAGCGGAAGGGACGGCACGG
AAGGAACCTGGTCGGTTCGAAAAAGCATTCCACAGAAGAG
AGCGGCTACGTGTCAGCTGCCCAGCAAGCACTTGCGCTGC
CAGGTATGGTGGATCAGAGTCCCTCAGTATCCACTTCCTT
CGGCCTCTCCACCATGAGCCCAACCAAAGCAGCCGTGGAC
AGCCTAATGAGCATTGGTCAGTCCCTCCTGCAGAGCACCA
TGCACCCTGGCGTGGGTGCTGAACAGCCCTTGCATGGCAA
CTCGCACCCCATGATGGGAGAAATCAAAACGGAGATGATG
CAAGTAGATGAGAGCGGAGAACATGAGAGCCCTAAAGCCA
TGGAGTCAATCGCCTCCAGCAATGGTGAGCGCAGCGGAGA
GCCAGACAAGAACCGTGATGGGCCGGGTACCCCTACCAGG
AGCAGCGTGATCACCAGTGCCCGCGAGCTGCACTACGTCA
GGGATGAAGGTCTGGGTGATCAGCAGGCCGAGGTCAGCCA
AATGGGGCTGGAGGCCATGGCGGGAATGACTGAAAAACAT
TTGGCGTCACTCTACGGCATTCCTTCTAATCACAAAAATG
AAGCGATGCTCTCGATGCCTGCCTCCATGGCCTCATCCTT
GCACATGTCCCCAGCCCTGGCCATGTCAATGGACTTCAGT
GCCTATGGGGGCTTGCTGCCTCAGAGCTTCATCCAGAGGG
AGTTCTTCAGCAAGCTCGGCGAGTTAGCTGCAGGGATGAA
GCCTGATGGCCGGAGCCTGAACGAGCGCTGCAACGTGTGT
GGAGCTGAACTGCCTGACAATGAGGCCATAGAGCAACACA
GGTAG

zbtb16a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zbtb16a-202 1445
zbtb16a-203 (1)    Ensembl 1485
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zbtb16a-202 Contained in:
[BAC] CH211-158E11 (1)
[Fosmid] CH1073-79B16 (1)

Genome Resources: Vega_Trans:OTTDART00000043392 (1),  Ensembl_Trans:ENSDART00000134103 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC046887 (1) 2326 nt
GenBank:EH580841 (1) 917 nt
GenBank:EE330884 (1) 857 nt
CITATIONS (2)