Transcript

ilvbl-202

ID
ZDB-TSCRIPT-091110-2130
Name
ilvbl-202
Previous Names
  • ilvbl-003
  • ch211-71n6.3-001
  • ottdart00000045342
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045342 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045342|OTTDARG00000013575|ZDB-GENE-040426-1623 ilvbl|OTTDARP00000035831 ilvbl-003 LG_none BX936429.8,CU469519.11 Danio rerio protein_coding KNOWN, 957 bp
CAGGTACAGTGTTTCCCTGACCTTAAACCAGGCTACAACA
AGAACACACATGACAGCGCGTAGAAACATGACCGCCGTCT
CGAGATTTGTCAAGTAACTGTACTGAAAAGTGCATTTGGA
GCTTAGCGTCATTATAAGTATGTGGCTGTTTTGTTAATTT
TACGCCTTTTTTATCGTCGGACAGGTCTCTAACAGGACAG
GTGGGCGTCAGGTCGCAGAGCACCGTCGCGATGGACATAT
CCATGTATTTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGG
TGTGATCTTTGCATCCTATAAACTGGGCTTACTTTACCAG
CTCTTTCATAAGACAGAGAGACAGAGTCCTCGACATGGAG
GAGAGAGTGTGGCAGAGGTTTTGCGTTCTCACGGTGTCAA
ATTCGTCTTCACTTTGGTGGGAGGACACATCTCGCCCATC
CTGGTGGCCTGTGAGAAGCTAGGCATCCGCATCGTCGACA
CCCGCCACGAGGCCACAGCTGTGTTTGCTGCTGATGCCGT
AGCGAGACTTTCTGGTACAGTTGGAGTGGCTGCGGTGACA
GCAGGCCCGGGTTTGACCAACACAGTGACCGCAGTAAAGA
ACGCTCAGATGGCTGAATCACCTCTGCTTCTGATTGGTGG
AGCTGCTGCGACTCTCCTGCAGGGTAGAGGTGCACTCCAG
GATATCGACCAGATGTCTCTCTTCAAGCCTCTCTGTAAGT
TCTGTGCATCAGTGAGGACTGTGAGAGAAATAGTTCCCAC
TGTTAGAAAAGCCCTGGCCATCGCACAGTCTGGAACACCA
GGCCCAGTGTTTATAGAGTTTCCCATAGACACACTGTACC
CGTATCATGTGGTGGAAAAAGAGTTTGCCCCCAAAAACAC
TCCCAAAGGCCTGATGGGGAAAATCATTGCATGGTATCTC
AAAAATCATTTATCAAACTTATTTGCTGGAGCCTGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations