Transcript

ilvbl-201

ID
ZDB-TSCRIPT-090929-3319
Name
ilvbl-201
Previous Names
  • ilvbl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016130 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016130|OTTDARG00000013575|ZDB-GENE-040426-1623 ilvbl|OTTDARP00000013695 ilvbl-001 LG_none BX936429.8,CU469519.11 Danio rerio protein_coding KNOWN, 3327 bp
GCTATTCTCCAAATGAATTCACAGAACGCTGGCCGCGCGA
GTACACTCAACTGCTCAAATAGCTGAGCGATTATTACGTA
TATAGCGTAACTCTCACATTCACCCAGTCCATTCAGAGCT
TTCAGTTTGCGTGGCCCGTCAACAGGAGTGAGTTCATCGG
CCTCAGCGCTGACTGCAGCAGGGGAGGAAAAGTTGGCACA
GGTCTCTAACAGGACAGGTGGGCGTCAGGTCGCAGAGCAC
CGTCGCGATGGACATATCCATGTATTTAGGCTGCTCTCTG
GGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTATAAAC
TGGGCTTACTTTACCAGCTCTTTCATAAGACAGAGAGACA
GAGTCCTCGACATGGAGGAGAGAGTGTGGCAGAGGTTTTG
CGTTCTCACGGTGTCAAATTCGTCTTCACTTTGGTGGGAG
GACACATCTCGCCCATCCTGGTGGCCTGTGAGAAGCTAGG
CATCCGCATCGTCGACACCCGCCACGAGGCCACAGCTGTG
TTTGCTGCTGATGCCGTAGCGAGACTTTCTGGTACAGTTG
GAGTGGCTGCGGTGACAGCAGGCCCGGGTTTGACCAACAC
AGTGACCGCAGTAAAGAACGCTCAGATGGCTGAATCACCT
CTGCTTCTGATTGGTGGAGCTGCTGCGACTCTCCTGCAGG
GTAGAGGTGCACTCCAGGATATCGACCAGATGTCTCTCTT
CAAGCCTCTCTGTAAGTTCTGTGCATCAGTGAGGACTGTG
AGAGAAATAGTTCCCACTGTTAGAAAAGCCCTGGCCATCG
CACAGTCTGGAACACCAGGCCCAGTGTTTATAGAGTTTCC
CATAGACACACTGTACCCGTATCATGTGGTGGAAAAAGAG
TTTGCCCCCAAAAACACTCCCAAAGGCCTGATGGGGAAAA
TCATTGCATGGTATCTCAAAAATCATTTATCAAACTTATT
TGCTGGAGCCTGGGAGAGCCGAGATCTGTCACCCCTTCCT
GTTCACATCCCTCACGCCACAGACGATCAGGTCCAAAGGT
GTGTGGAACTGGTGAGCAGAGCCAAGAAGCCTGTCATATT
GTTAGGCAGTCAGGCAACTTTACCCCCAACACCAGCCGAT
GATATCAGAAAAGCTTTAGAGTCTTTAGGCATTCCCTGCT
TTTTGGGTGGGATGTCCCGAGGGTTGCTGGGAAAGAACAG
TCCACTGCACATCAGACAGAACAGAAGAGACGCATTAAAA
GATGCCGACCTCGTCCTGCTGGCAGGCACGGTGTGTGACT
TCAGACTAAGTTATGGACGAGTGCTGAACAGACGGAGCAA
GATCATCGCAGTGAACAGAGACAAAAGTCAGCTACTGAAG
AACTCCGACATGTTCTGGAAGCCAACAGTGGCCATTCAAG
GTGATGCTGGTTCATTTCTCCTGAATCTTTCGAAAGCCCT
AAAAGGACACAGATGCCCAGAGGAATGGCCGCAGAGCCTG
AAAGAGGGAGATAATGTCAAAGAGAAAGCTAACAGAGCGA
AAGCAGATGAGAAGACCGAGAGGCATTTGAATCCTCTGAG
TGTTTTGCACCGTGTGGATGAGCTTTTGGCTGAGGACAGC
ATCATAGTGGCTGATGGGGGGGATTTCGTGGGCAGCGCTG
CATATATCATGAGACCCCGCGGCCCGCTCTGCTGGCTGGA
CCCAGGGGCTTTTGGGACTCTGGGTGTTGGAGGAGGATTT
GCTCTGGGAGCAAAGCTTTGTCGACCTGAGTCTGAGGTAT
GGATTGTTTATGGCGACGGTTCTCTCGGATATACAGTGGC
TGAATTTGATACCTTTACACGCCACAAGACCCCAGTGATT
GCTCTGGTGGGAAACGACGCCTGCTGGAGTCAGATCTCCA
GAGAACAAGTGCCTATGCTCGGCAGCAACGTCGCCTGCGG
TCTTGCCTTTACAGATTACCATGTTGTAGCTGATGGTTAC
GGGGGGAAAGGTTATCTTATTGGCCGAGAGGATGAGTCGC
AGCTTGAAGACATCATTAAGAAGGCGCAGAAGGAGTGCAA
AGAGGGAAAAGCCGTTCTGCTCAACGTCCTAATCGGAAAG
ACCAACTTTAGGGAAGGTTCAATCTCAGTTTAGTGTGCAA
TATTCTGCCTAGATACCCAAAGTTTTTCTTGTGTTCGGAA
TATACCACAAGATCCTCCCTTTAATATGAAATTTTGGATA
CAGCTGATTTGAAAAGAGAGCGAAGCAACAATTAGACGCT
CATGAAAAGTCATTTTTGTGACTAATCTGAATTATATGTC
ATCCCAAAACCAAAATAAATAGCAATTTAATTGAAATCAA
CGATGATAATTGTCCTCAGCCCATTATTATTATTATTAAC
GTAAAACCAAAAAGGGAGATGATAGTTAAATTATTTTATT
TGTATTTAATCACACTATGGTAATATTTGATGCGCTCTAT
TCGAATTGATAACACAAATATTGTATGTATATAAAGTTAT
ATATTCAATTTGTTTTGATTTGGGCTGAAATATGAGCTTG
ATGTGTATTTGAAATAATGAAAGTACTTTCTCGTTCAGCG
GAAAAGGAGCAAACACAGTGCCTTTACTCTGTATATTTGC
ATTTGTACTGTAAAATCAGAAAGCATTTTAAGATTTAAGC
CGTGGCGGTCGAGTAAATATGGACTAAAATGATTATTTTA
AAGCACATATCACCACTTGATTACATAATAATGCTGTTGA
AGGGTAAAGTGCCTGTAATTACTGAATGTGAAACTGAGAA
ACGGAGGTTTGATAGGAAGAACTCTGTCTGCAGTTATTGT
GAACAATAATGAACTAAATAAGTTTGATACAATGCAAGAA
ATGCTTTTCTTACTTAGACTTTTTGTCTTGTTTCTTGTCC
CAATATCATACAAGTCTTAAATCAAGAAGCATTTTCTAGA
CAAGCATAAAAGATTGTCTTGTTTTTAAAAATAATATCAA
AATTAAGTATTTTCCCTTTTAACAAGCAAAATATCCATCT
GCCAATAAGATAAGAAAAATTATCTTGTTTTTGCTTTGAA
ATAAGATTTTACTTGCCCCACTGGCAGATTATCTTGCTTG
TTTTGAGGAAAAGGCTTCATGGTTCAAGATATTTGGGTTA
GAAACAAGACAAAAATTCTAAGTTAGAAAGGCATTTTTAA
AGCGTATCTAATAAAACCTAAACCAAAGTAATATTCTCAC
TCACTTTTGAAAATGCAGTGTTGTGTTTTTGCAGACCTGA
ATATACCTTTAATGCCTCTCCTTGGTTTGTGATGGATCTT
TTTGGCATCATCCACAACTTCCTGATGCAATAAACTAATT
TAAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations