header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-2122
Transcript Name: lmo2-201
Previous Names: lmo2-001, lmo2_2-001, ottdart00000045320

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045320 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045320|OTTDARG00000032442|ZDB-GENE-980526-419 lmo2|OTTDARP00000035815 lmo2-001 LG_ CT025900.11 Danio rerio protein_coding KNOWN, 1805 bp
TCATTGTCGAGCCGTCGTGAGCAGGAAGTCGGAAAAGAGC
AGAAACTGAGGGGGCAGGGCCATTTAAAAATACCTGCTGC
CCTACAATAACGGGACACAGAGACAGCAGCCCTGCGGGAC
ACTGGCGTGGCGACTTGCAGCGCAAAATGCACCACAAACA
AGACGGAGCCTAAACGCCACATTTATCACGCGCCGGAGAA
ATTGAACAACGCCACTGTCTGTCACCTCACATTATTCAGA
CAGAACATAGGACTGAATGCGTGGTGACAGAAATCTAATG
TAAATGAAGGATGCTTGGAATCTGGCGTACACAATGTGTG
CTGGATGTTTCTGACCTTTGATACACTTGCTAAGACAGCA
GAACAGGTGCATCTCTGAAGCGTTTTGTGCGGCAGATGGT
CTTTCGGAACCGCAGAGGGCGAGTACGGGACATATTTGGC
TTAAAAGGCGTGCATACCAAATGTGCTGAATTATACCTGA
ATCATATTGAAAATGGCTTCTACAATTGAACGGAAAACAC
TGGAGGCAAATGAGGAGCCGGTGGATGAGGTGCTCCAGAT
GCCGCCGTCACTGCTGACCTGTGGCGGGTGTCAGCAGAGC
ATCGGAGACCGCTTCTTTCTGAAGGCCATCGAGCAGTACT
GGCACGAGGACTGTCTGAGCTGTGACCTCTGCGGCTGCCG
CTTAGGGGAGGTGGGACGCAGGCTTTACTACAAACTCGGC
AGAAAGCTGTGCAGGAGAGATTACCTCAGACTGTTTGGTC
AGGACGGACTCTGTGCTTCCTGTGAAAAGAGGATCCGGGC
CTTTGAAATGACCATGCGTGTGCGTGACAAAGTCTATCAC
CTCGAATGCTTCAAATGTGCTGCCTGTCAGAAACACTTCT
GTGTTGGAGATCGTTACCTGCTCATCAACTCGGACATTGT
GTGTGAGCAGGACATTTTTGAGTGGACCAAACTCAACGGC
AGCATAGTATAGTTTTCTGCCGAAATCATAAACAAAATGT
AACCTGTCAGCATTTTCAACAAACCCTTTACTAATAGAAC
ATCAATAACAAAATATATATTTTAAAGAAATGATCTTTCT
GGCTCTATTAGCTGTGCTCTAAATGCTTGTCTCTTTTTGT
TATTTAAACTTGAGAAAAATGCCACCAGGTTTCCCAGTGT
TGGGTTGCAGCTGGAAGGGCATCCACTGCGTAAAACATAT
GCTGGATAAGTTGGCGGTTCATCCCGCTGTGGCGACCCCT
GATTTTTAAAGGGACTAAGCCGAAAAGAAAATGAATAAAT
GAATGATAATTGCCACCAGCAACATGAACCTTTTTTAAAT
TTGATGTATTTTTGCAGAACAGCGTTATACAATTTTTAAT
GTATTGCAATAAAAACTGATTCCCTTTGCTACTTTTACAC
AATTACTTCGATTTGAACTATAGTTCTATTTGTTTTGAAG
TAACACAATTGCAATAAAATGTACAGACATCTTAGAAAGA
TGATGCTTATTTTCTCAAGCTGCATTTTGTTCACTGGACA
ACTGTTTTCTGTCAATTTTTAAAAATGTATTTTATTTTTG
TGATGCAAGGCTGCATTTTCAGCAGTCTTCAATCCCATCT
TCAGTGTCATATTAGCTTTAATTGGAGCTCAAGAAACATT
TTTTCACATTATTTTTTATTGTGTGATGCTTTTTTGTGAT
GTGATATCTATAATATGTTATCAAAGTGCCAACAGAGCAC
ACCCAATATTCCTAAAAGGACATATTGTATACATTTCATA
TATATTGTGTACATATTGTATGCCAAAAAAAAAAAAAAAA
AAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmo2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045320 (1),  Ensembl_Trans:ENSDART00000134247 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF191560 (1) 1726 bp
GenBank:BC093136 (1) 1327 bp
GenBank:CK239232 (1) 797 bp
CITATIONS (2)