Community Action Needed: Please respond to the NIH RFI
Transcript

jam2a-202

ID
ZDB-TSCRIPT-091110-2118
Name
jam2a-202
Previous Names
  • jam2-002
  • jam2a-001
  • ottdart00000045286
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045286 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045286|OTTDARG00000032421|ZDB-GENE-031204-3 jam2a|OTTDARP00000035789 jam2-001 LG_ CU571081.7 Danio rerio protein_coding KNOWN, 707 bp
CACACACGCGCAGGACCCGCGCGCTCTCGCTCCTCCAGCA
CAGCTCAGTCAGTGAGAGTTTGACCATCAGCGGTTTTCTG
CACTCCAGCGCTTTTCCCCCTCCAGCTCTCGTTTTCTCGG
ATTCTCCTGAAAGTTCGTCCACTGTGGAGAAAATGCTGGT
GTGCGTGTCTCTGCTGATATTAATTCACAGCGTCCCTGTG
TCTCCCGTCACCGTCAGCAGTCGCAATCCTAAAGTGGAGG
TGCACGAGTTCTCAGACGCAGAGCTCTCCTGCGAGTTCAA
GACTGAGAAAGACACCAACCCTCGCATCGAGTGGAAGAGG
AAAGACAAGGAAAAAGACGTGTCCTTCGTCTACTATGGAG
AACGATTCGTAGGGCCGTTCCAGGATCGCGCAGATATTGA
AGGAGCGACAGTGCGGCTACGCAGGGTCACTCAGGCGGAC
GCAGGCGAATATCGTTGTGAGGTCAGCGCTCCGAGTGACT
CCATCTCACTGGGAGAAACCAACGTCACGCTGAGAGTGCT
GGTTCCTCCTCAGACTCCCTCATGTGACGTGCCCAGCTCT
GCTCTGACGGGCTCTCAGGTGGAGCTGCGCTGTAGAGACC
GACACAGCATCCCACCTGCCGTCTACACCTGGTACAAAGA
CAACCGCGCACTGCCCATCCGCCATCCCAACGCCACCTAC
ACCGTCAATGAGTTCACCGGTGTACTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations