Transcript

prkar1b-202

ID
ZDB-TSCRIPT-091110-2084
Name
prkar1b-202
Previous Names
  • prkar1b-001
  • ch211-103a8.2-001
  • ch211-8c17.4-001
  • ottdart00000045048
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045048 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045048|OTTDARG00000032284|ZDB-GENE-060929-580 prkar1b|OTTDARP00000035614 CH211-103A8.2-001 LG_ BX908774.13 Danio rerio protein_coding NOVEL, 1428 bp
TCTTTCACAGGTGATGAAGGAGACAACTTCTATGTGATTG
ACCAAGGAGAAGTGGATGTATATGTGAATGGTGAATGGGT
GACTAGTATTGGAGAGGGTGGTAGTTTTGGAGAACTGGCT
CTGATATACGGGACTCCTCGAGCTGCTACTGTGAAGGCCA
AGACTGACCTGAAACTCTGGGGCATCGACAGAGACAGCTA
CCGGCGCATCCTCATGGGAAGCACGCTGAGGAAGAGGAAG
ATGTATGAGGAGTTCCTCAGCAAGGTGTCTATACTCGAAT
CGCTGGATAAGTGGGAGAGGCTGACGGTGGCTGATGCTCT
GGAGCCTGTGCAGTTTGAAGACGGAGAGAAGATCGTAGTG
CAGGGAGAGCCAGGAGATGATTTCTTCATCATAACAGAGG
GTACGGCGTCTGTTCTGCAGCGCAGGTCTGATAACGAGGA
ATACGTTGAAGTGGGCCGCCTGGGTCCATCAGACTACTTC
GGTGAGATAGCGCTGCTGCTGAACAGACCCCGTGCAGCAA
CAGTCGTGGCCAGAGGTCCACTCAAGTGTGTGAAGTTGGA
CCGTCCGCGTTTCGAGCGCGTCCTCGGGCCCTGCTCTGAG
ATCCTCAAGAGGAACATCCAGAGATATAACAGCTTCATTT
CTCTCACAGTCTAACCCGGCCGTCTGAAACGCGTTGCCGT
CAGGTTATCCGGGTGCCTGGTTGCATAAAATAACGTGACG
TTCTCCACCAGTTCTGCTTAAATCATTAGCTTCAGTATTG
CTGAGTTGTTCAGAATGGATTCAGCAGTAGATAATAAAAA
CGACTTCTTTTATGCAGCCAAGCATTCAGTTTTTACTTTT
TTGCCAGAAGCACAAGTGCTCCACCTGCTTTTTTTTCCCC
TTTGTGTGATTTTTCTTACTGTATGTGCACTTTGAATTTG
ACCTATGTCGCCACAAAGCTTTATTTCTGCAGATTAGGAG
AGGAAATGAGGTGCCCATATGGACTGATAAGAAACATCTT
CATGTGGCATGTGAAAAAAGTCCTACAAAATGTGATGCAT
GCAGACCAGAGATGCATTTTGTTCACTTGCCATTCAGATT
CTGCGTCGAAGAGGAAGGTAACAGTACAGATGGCACAAGT
ATATAAATATGTTTACACAGAGGAAGGAGTGTTTATGTTT
TTGTTCTTCAGCTTCTGCCTTTTAGCTGTGTGTTTTTTGC
GTGCCGTGTTTAATCCTGCGTGGGTCAGAATTGGAGATCC
TCTGTTTATTGAAATCTGTTTATTGAAAGCGATTTTGCCG
TTCTATATCTTCTTGGCTGTTTCATCCACCCTGAACATTC
TGAGTTGTGCTTCTACAGCTGGAATTAATGGGAGGGGGTT
TGTTACATTTTAAGACACGAGTTTTAATATAGAACTGCTA
TAAAAGCGGTTTTCATTGGGAGTCTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations