Transcript

skilb-202

ID
ZDB-TSCRIPT-091110-1994
Name
skilb-202
Previous Names
  • skilb-001
  • dkey-150o13.3-001
  • dkeyp-72f10.7-001
  • ottdart00000044632
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044632 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044632|OTTDARG00000032009|ZDB-GENE-080723-40 skilb|OTTDARP00000035272 DKEYP-72F10.7-001 LG_ CR450695.14 Danio rerio protein_coding KNOWN, 2193 bp
GTGACGGCGACGGGCGAACGGTCGACGGTGAACTCCGAGG
CGGAATCCCGAGATATTGAAAACACACACATATTTAACGC
GCTGTCCTTCTCTTATCGTCAAAACAAAGCTGAATTGACA
CTCAGGATTTAAAGTCATCCGGGAAGAAGACCTATTATGA
TCCACATATAAAAAGCACTGCATTCCTCAGACTTCCCCTT
GCGCATCTTCTGTTCCCCAAAGACCACTTAGCGATATCCA
TAAACAACATGACTACCACTGAAAACAAGCGTCCAGACGT
CCCCAAGGATCAGTCACTTCTAAAAGTGCCATTAAAGCGC
TTAATGCGAGACAATGGTACGGACGGCACACCCATAAAGA
AGCGTGTGATGGCTGCTCTCAATCTGTCCTGCAAAAAAAT
CCCAGAAACCTCCCTCGGCAAGGCGGAGGCCAATCCGGAT
CTGAGCCCAGGACTCAAACACACTCTAGCGCAGTTCTCTC
TGAGCAGCCAATGCTCCCTTGGTGGCCCGGCTGCATTTAC
CAGCCATCATGGTCAATATAAGTTGGCGCCCCCTTTGGCG
CATGGAGGTATTGCAGGCGGGCCCCTGTTAGTCCCTCCTG
ACAGCTCCACAGACCTCAGCATGTGCTCTCTGGAAGGCGA
ATCAATCTCCTGCTTCTCAGTTGGAGGAGAACTACGTCTT
TGTTTGCCTCAGCTGCTAAACACTATCCTTCGGGATTTCT
CGTTGCAACAGATAAACTCTGTGTGTGATCAGCTTTACCT
GTACTGCTCCCGCTGTGATGCCACACAGTTGCACATCCTC
AAAGTGCTAGGCATCCTCCCTCCGGGCACTCCATCCTGCG
GCCTCATCACATTAACAGATGCCCAGCGTCTTTGCAACAC
CCTTCTCCATCCAGGCGAAGAGCCGCTAGACAGGGAGCAG
GAGGAAAAAGATGGCGAGGAATCTGGCGGATTTTGGGTGG
AACACCAATGTTTGGGCAAGTGTCAAGGTCTGTTTGTTCC
TCAGCTTTACTCCAGTCCGGATGCGCCCTGCGTTCGTTGT
TCTCAATGCCGGATGCTTTTCTGCACGGAACGCTTTGTTA
TGCACTCGCACCGACAGCCGGACAAACGCACTTGTCACTG
GGGCTTCGATTCAGCCAAGTGGGCCTGCTATCTGCAGCTG
GCGCAAAGACACCTGGGAACGGCAGATGAGGAAAAGCTAC
AACAATCTTTGGAGGACATGAAGGCCAAGTTCCAGCAGGA
GAAGAGGCAGCCTCATGTAGGAGTATCATCACCTGCTTTT
GTTTTCGACTCACGCTTGCTTGCCGGTCTGAAGGAGGAGC
CCAGTAATGATGACTTGATGTGGCAAAGCTGGTACCAGTA
CACACATGACAAGCCGGCAGGTAATGGTTTGGCACAACAC
TCTGGCTGTGTGCCTGAAAAGGAAATGGGGTCTCCGGGAA
CAGAGATGCAGACTGATACTCAGGATGAAAAGAATCAGGA
TGCACACGACACCGACACAAAGACCCTCACCTTCACAGGC
CAAGAGAAAAGTGTCCAGTCAGATGACGGCAGTGCGGATG
AATGGCAGAGAATGGCAGATTCGCCGGATTGTAAGCGGTC
TGTAGAGCACAGTAAGGACAACATGGTGATGGAGCTCCTA
CAGATGTACAGCGCTCAGCACGACAAACTCCAATCCACAC
TGTACAGACAGAAGCAGCTCGAAAAGGAGCTGCAGGCGCT
GCGTCAGGGTGAAACCCTCGACCGATGTGACCTTCACGGA
GAGCTTGAGGCCGTTCAGACCGAACACGCTCAGCGGCTCG
GTGAAGTCCAGCAGGAGCAGAGAAAGCTGAAGTCCAGACT
TGACCAGCTGAGGCAGCAGGAGTGCAGATGCAAACAACTG
AGCACTGAGACGCACCAGGAAACCATCTACGCCAGACAGT
TATCAGAGCTGCGTCAGAGGCTGGACCGAGCAGAAGAAGA
CAGAGAGGAGCTGCAGGAGGAGCTGCGCAGAGAGAGAGAA
GCCAGAGAGCGGCTGGAGAGAACCATCTCTGAGCTCAAGC
AGCAGATGAGGGAGTCCACACACCCCGCACAACACGACTC
AATGGACAGTCCCAGCGACACACACATGTCGCCTGCCTCT
TAGTCTGATCCGGATGGATTCTGCAGTGTGCTTTTCAGTT
TGGACTTTGGATGCCAGAGCTGCTTTCAAGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations