header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-194
Transcript Name: si:dkey-250d21.1-201
Previous Names: dkey-250d21.1-001, dkey-3h23.2-002, ottdart00000043266, si:dkey-250d21.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043266 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043266|OTTDARG00000031115|ZDB-GENE-030131-8276 si:dkey-250d21.1|OTTDARP00000034297 DKEY-250D21.1-001 LG_none AL953904.10,CU467651.8 Danio rerio protein_coding PUTATIVE, 2338 bp
TGTGTGAAAGTAGCAACATTTCGGCCATGAGCAAGTTACA
GCAGAAAGCACGCGACGTTTGGAAATAACGCTCGATTGTC
TGAAATCTACAAAGACGCGCACGCGCGCTTTTTACTGTCA
AAGCCTCTCCTTTTGCGCCGGAGGATTCATGCAATGCAAT
ATTCATTTTGATTAAGTCCAAAATGCCCGACTGCTGTGCC
GCAGCAAACTGCAAGCAGAGCACGGACCAGTCCAGTGTTT
CCTTCTTCGAGTTCCCGCTGGATCCAGATCGATGCAGGCA
ATGGGTGGGTAGATGCAACAGGCCTGATCTGCAGACCAAA
ACACCTGAGGATTTACACAAAAACTACAAAGTGTGCTCTA
GGCATTTTGAGACGTCGATGATATGTCAACAAAGTGCTGT
TAAGTGTATTTTGAAGGATGATGCCGTTCCTACTCTATTC
AATTTTTCAACCAACCAGGACAATGCACAAACAAGCAAAA
GAAAAAGGACAAGGGAGAAGACTGGAGAGGAGCCAGTTGT
CCCAAAGAAAACTAAAGGTACCACCGATGACCCAAACCTC
TCTGCTACAGAGATGGAAGTTAAAGTTGAGGGTGTCTCAG
CTGAGATCAGCGAAATACAGAATCCTCCTGCACATGATGA
AACGGAGAAGGAGGATCCTGCTATTTCCAAAGCGAAGGAA
ATTTTGAAAGAGTATTTCAAGGAGACGTTAGCCTTCACTG
GTTTCAGCATCAATAACAAGGCATCCCTTAACCCAGGTGG
GACGCTGTCTGTCAATACCATGTGCTCTGAGAAAATTGAC
CAAAAAGAAGTGCTAACCTTAGGCGAGGAAGTGATGCGTG
AAGAGATCCGCAATAGCCTGCGCCTTGCACGCTTCTTTTC
TATACTTTTGGAAGACAAAACAAACATTGACGGTGTGGAC
CAGATTCCTGTGTTTATCCGTTCTGTCACAAGTGGAGGCT
ACCCACAGAAGCACCTCCTGGCATTTCTCCCCTGTGATGT
TGACTCTGAAAGTCTGTTTCACATGCTTATATCTGAGATT
CGTAATAAGTGGGGCCTGCGGCTGGAGCACTGCCGTGGCT
TCACCTACTTATCATCAGGTGTCATGTGTCAGAAACTGAA
GGATTTCACCTGTAGGATGCTGCGGGATTTTCCACAGGTA
GTTCTGTCCCCGAGCGAGCCTTATGCCTTTAATGTGTGGT
TGATTCGCTCCATGCCTATCCTTCCCATTCAAGAGGTTGT
TGATACCGTAGAGCAAGTTGCTAATGTTATCAGGCAGTCA
GAAACTCTGGCGAAAAAACTTGATGCTAAGATTACCACCT
TATACGGCCATATCAAAGGTGAAGTGGACAGAGTCAAAGA
TTCTTACCAGAACCGTTGGGAATATGCCACAGATGCTTTC
CAGACAATGCTTGACATCTTGGAGCCGCTTTTGAGCAGCA
TTGGAGAGATGTGCACCAGTGCTCTTTCAGATGTGGATGC
AGAGACTGTTGAAGCACTTCTAAAACTGAAAGAGAAGCTG
AAGAATTTTAATTTCATCATTACTCTTGTGGTCTTGAAGA
ACACTCTGTGTTGCGTAAGCATTCTGAACCCCAGCCTTAG
GGGAATAATCAGCATAAGCAGCACTTTACAGTACACCATC
TCCAATGCCTTAAAGCTTCTCACCAAACATATGCAGGAGA
TTCCCATTTTTCACAGAAAGTGGTTCTCTGATGCATTGGG
CAGAGCCAAGAAGTTGGGGGTGCCAGTCAATTTACCAGCA
GACATGGTGACAAATGGTGAAAGCGCAGAAAATCCTCAAG
CCGCATTGGAGGATTACTACAGGGAGGCACTGAGCAAGAA
AGTTTTGCAGTACCTTATTGATGAAGTCAAAAGAGTCCTA
GGCACTGAAATGGCAAGAATTCTTAGATGGTTGTCATTGG
TGCCCTCATACATGGCTGACCACAATTTCAGCATCCGGAA
AGACAAAGTTGCTGATGCTAACCTGAATAACTTGGCTCGT
CCAGATTCATTTTACGATGAACTGGGGTGTTGGGAAGTGA
AATGGAGGCATGCTAGCAAGCGGAGAATTCTTCCCACCAG
TGTGTTTGCTACCCTTAAGATTCCAGATATAGGATTTTAC
CCAAATATACAGAGCCTTTTGAGAGTGCTAGGCACTATTC
CTTGCGTCCACGCCGAAGCAGATGTATATGGGCAGTACGA
CATGGTGCTGAACCGGTATCATTCCTACATGAAAGAAGTA
ACAGCGGAAAAGAGACTGAGCAGTATGGCCTTTGTTTATG
TCAATCAAGATGTCAACTTCAGCTTTGAGGAAATGGTGGA
AGCATATGTAAAGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-250d21.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043266 (1),  Ensembl_Trans:ENSDART00000062311 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC054900 (1) 2346 bp
GenBank:AW422263 (1) 663 bp
GenBank:AL920274 (1) 539 bp
CITATIONS (2)