ZFIN ID: ZDB-TSCRIPT-091110-1936
Transcript Name: asap1b-002
Previous Names: asap1-002, dkey-37o8.2-002, dkey-37o8.2-004, ottdart00000044395

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044395 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044395|OTTDARG00000031871|ZDB-GENE-091112-16 asap1b|OTTDARP00000035098 DKEY-37O8.2-002 LG_ AL840641.22 Danio rerio protein_coding NOVEL, 669 bp
ATTAAGAAGGATCGCTCACCCCGTCCGCAGAGTTTCTGCC
ACTCATCCAGCCTCTCCCCTCATGATAAGCTCTCTCTGCC
TGCTTTCATTGGTCAGCGTGATAAGCAACGCCTCTCCTAC
TCTGCATTCACCAATCAGATGTACAGCGTTTCCACCGACT
GTCCGTCCTCTCCGGTTTCAGATGCTCCACCTCTGCCGCC
AAGGAATGCTGGCAAAGGAAGTGATTCAACGCCGCCTCCT
GTCAACAAGATGTCCCCTGTAACTAATAGATTTGAGGGCA
TCCCACAACAGCAAAGTCCCAACACCACCAAGCCCACACT
TGGTCCAAGGGTCCTTCCCAAACTACCTCAGAAGGTTGCC
CTGCGTAAGATAGACACCATACATCACCCATCTGTGGACA
AAACCAACCAGCCTTCTGAAGCTGTCCTTTTTCAGAAAGT
TCTGCAGAGTTCAGATACATCCCAGAAAGTTCCGATAGCT
GACAGGCCTCAGCCTGGAGACGTCGCTCCACAGCGACCAC
AGCCTTCAGAATTACCACCTAAACCAGGAGAACTGCCTCC
AAAGCCTCAACTGTCCGAACTTCCCCCTAAACCCCAGTTG
GGTGACCTACCACCTAAACCTCAGCTTAAAGATCTCCCGC
CCAAGCCCCAACTCGCAGACATCTCCCCA

asap1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA asap1b-001 (1) 4009
asap1b-002 669
asap1b-003 (1) 1048
ncRNA asap1b-004 (1) 821
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asap1b-002 Contained in:
OTHER asap1b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044395 (1)
  • Ensembl_Trans:ENSDART00000144372 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)