ZFIN ID: ZDB-TSCRIPT-091110-1936
Transcript Name: asap1b-204
Previous Names: asap1-002, asap1b-002, dkey-37o8.2-004, dkey-37o8.2-002, ottdart00000044395

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044395 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044395|OTTDARG00000031871|ZDB-GENE-091112-16 asap1b|OTTDARP00000035098 DKEY-37O8.2-002 LG_ AL840641.22 Danio rerio protein_coding NOVEL, 669 bp
ATTAAGAAGGATCGCTCACCCCGTCCGCAGAGTTTCTGCC
ACTCATCCAGCCTCTCCCCTCATGATAAGCTCTCTCTGCC
TGCTTTCATTGGTCAGCGTGATAAGCAACGCCTCTCCTAC
TCTGCATTCACCAATCAGATGTACAGCGTTTCCACCGACT
GTCCGTCCTCTCCGGTTTCAGATGCTCCACCTCTGCCGCC
AAGGAATGCTGGCAAAGGAAGTGATTCAACGCCGCCTCCT
GTCAACAAGATGTCCCCTGTAACTAATAGATTTGAGGGCA
TCCCACAACAGCAAAGTCCCAACACCACCAAGCCCACACT
TGGTCCAAGGGTCCTTCCCAAACTACCTCAGAAGGTTGCC
CTGCGTAAGATAGACACCATACATCACCCATCTGTGGACA
AAACCAACCAGCCTTCTGAAGCTGTCCTTTTTCAGAAAGT
TCTGCAGAGTTCAGATACATCCCAGAAAGTTCCGATAGCT
GACAGGCCTCAGCCTGGAGACGTCGCTCCACAGCGACCAC
AGCCTTCAGAATTACCACCTAAACCAGGAGAACTGCCTCC
AAAGCCTCAACTGTCCGAACTTCCCCCTAAACCCCAGTTG
GGTGACCTACCACCTAAACCTCAGCTTAAAGATCTCCCGC
CCAAGCCCCAACTCGCAGACATCTCCCCA

asap1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA asap1b-202 (1)    Ensembl 1048
asap1b-204 669
asap1b-205 (1)    Ensembl 4009
ncRNA asap1b-004 (1)    Ensembl 821
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asap1b-204 Contained in:
[BAC] DKEY-37O8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000044395 (1),  Ensembl_Trans:ENSDART00000144372 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)