ZFIN ID: ZDB-TSCRIPT-091110-1215
Transcript Name: asap1b-001
Previous Names: asap1-001, dkey-37o8.2-001, dkeyp-28d2.6-001, ottdart00000044394

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044394 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044394|OTTDARG00000031871|ZDB-GENE-091112-16 asap1b|OTTDARP00000035097 DKEY-37O8.2-001 LG_ AL840641.22 Danio rerio protein_coding NOVEL, 4009 bp
ATGAGGTCATCATCCTCTCGTCTTAGTTTTTCCTCTAAGG
AACCCATATGGAACAGGATGCCAGATCAAATATCGGTGTC
GGAGTTTCTGTCGGAAACAACAGAGGATTACAACTCTCCC
ACTACATCCAGCTTCACCACCCGCTTGCAGAGCTGCAGGA
ATACAGTCAGCGTGTTAGAAGAGGCTTTGGATCAGGACAG
AACGTCTTTGCAGAAGGTCAAGAAGTCAGTCAAAGCCATT
TACAACTCTGGCCAAGATCACATTCAAAATGAGGAAACGT
ATTCCCAGGCATTGGATAAATTTGGCAGCAACTTCATCAG
TCGGGATAATCCAGATCTGGGCACAGCCTTTGTTAAATTC
TCCACTTTGACTAAAGAGCTTTCTGCCCTCCTCAAGAACC
TGCTTCAGAATTTAAGTCATAATGTGATCTTTACACTGGA
CTCCCTGTTGAAAGGCGACCTGAAAGGCGTGAAGGGGGAC
CTGAAAAAACCCTTTGACAAGGCTTGGAAGGACTACGAAA
CCAAGTTTACAAAAATCGAAAAGGAAAAACGTGAGCATGC
CAAACAGCATGGAATGATCCGAACAGAGATCACTGGTGCT
GAGATCGCAGAGGAGATGGAGAAAGAAAGGAGGCTCTTCC
AGCTACAGATGTGTGAGTACCTGATCAAAGTAAATGAAAT
AAAGACCAAGAAAGGAGTTGACCTCCTTCAGAACTTGATC
AAGTATTACCACGCGCAATGCAACTTTTTCCAAGATGGCT
TGAAGACGGCAGATAAACTGAAGCAGTACATTGAGAAGTT
AGCAGCTGATCTTTACAATATAAAACAAACACAAGATGAA
GAGAAAAAGCAGCTCACGGCTTTAAGAGATCTCATTAAAT
CCTCTCTACAAGTGGACCAAAAGGAGGACTCTCAGAGCAA
ACAGGGTGGCTACAGTATGCACCAGCTGCAGGGTAACAAA
GAGTTTGGCTGTGAGAAGAAAGGCTATCTGTTAAAGAAGA
GTGATGGGTTAAGGAAGGTGTGGCAGAGAAGGAAGTGCTC
AGTTAAAGGCGGGATTCTCACCATCTCTCACGCCACTTCA
AACAGGCAGCCTGTCAAACTCAACCTGCTCACATGCCAGG
TCAAGCCCAGTGCTGAGGACAGAAAGTGCTTCGATCTTAT
TTCCCATAACCGCACATATCACTTTCAGGCAGAAGATGAG
CAGGAATTTATAATATGGATCTCAGTGTTAACTAACAGCA
AGGAGGAGGCACTTAACATGGCCTTCAGAGGAGAGCAGGG
TGGAGGAGATGATGGGCTGGAGGATCTCACCAAAGCCATA
ATCGATGATGTGCTGCGCATGCCGGGAAATGAGTGGTGCT
GTGATTGTGGGGCTCCAGATCCCAAATGGTTGTCGACTAA
CCTGGGAATCCTGACATGCATCGAATGTTCAGGCATACAC
CGGGAGATGGGCGTCCACATCTCACGCATCCAGTCTATGG
AGCTAGACAAACTGGGAACCTCCGAACTCTTGCTGGCCAA
GAATGTGGGGAACAGTAGTTTTAATGATATAATGGAGGGA
GGTCTTTCTTGTCCCTCTTCTAAACCCACTCCCTCTAGTG
ACATGACTGTTCGTAAGGAGTTCATCAATGCTAAATATGT
AGATCATAAGTTTGCAAGGAAAACCTGCAGCTCAGCAGAA
GACAAGAGGAGTGATCTTTTTAAAGCCGTCGGGTCACATG
ACCTGCTAGCTCTCATCCAGGTGTATGCTGAGGGGGTAGA
GCTTTTGGAACCACTACATGAAGGAGGACAGGAAGGTGGA
GAGACTGCATTGCACTATGCCGTGAGGACAGCTGACCAAA
CCTCACTGCACCTGGTCGACTTCCTTGTCCAGAACAGTGG
GAATTTGGATAAGCAGACGGAGCGAGGAAACACGGCCCTG
CACTATTGCTGCCTGTACGAGAAACATGAATGCCTCAAAC
TACTGCTCCGAGGCAAACCAGCTACTGATATCACCAATCA
GAATGGGGACACAGCTTTGGATGTGGCTAGGCGGATGAAG
CTCTTCCAGTGTGAGGAAGCATTGGTACAAGCTGCTGCTG
GAAAATTTAATACTAAAGTCCATGTGGAATATGAATGGAA
TCTCAGGTTGGAGGAGCTTGATGAAAGTGATGATGATCTG
GATTACAAACCAAGTCCCATTAAGAAGGATCGCTCACCCC
GTCCGCAGAGTTTCTGCCACTCATCCAGCCTCTCCCCTCA
TGATAAGCTCTCTCTGCCTGCTTTCATTGGTCAGCGTGAT
AAGCAACGCCTCTCCTACTCTGCATTCACCAATCAGATGT
ACAGCGTTTCCACCGACTGTCCGTCCTCTCCGGTTTCAGA
TGCTCCACCTCTGCCGCCAAGGAATGCTGGCAAAGCCCCT
CCATTGTCGAACCTGCCTCCCTCCACCCTTGCCCCTGCAT
CACAGACCTCACCTAGTGGCAGCTCTACCCTGTCAAAGAA
GAGACCCCCTCCCCCTCCCCCTGGACACAAACGCACGCTA
TCTGACCCCCCTACCCCTCTCTTTAAAGGTGGGCTACACT
TTAGGCAACAACCCTTTGATTCAACGCCGCCTCCTGTCAA
CAAGATGTCCCCTGTAACTAATAGATTTGAGGGCATCCCA
CAACAGCAAAGTCCCAACACCACCAAGCCCACACTTGGTC
CAAGGGTCCTTCCCAAACTACCTCAGAAGGTTGCCCTGCG
TAAGATAGACACCATACATCACCCATCTGTGGACAAAACC
AACCAGCCTTCTGAAGCTGTCCTTTTTCAGAAAGTTCTGC
AGAGTTCAGATACATCCCAGAAAGTTCCGATAGCTGACAG
GCCTCAGCCTGGAGACGTCGCTCCACAGCGACCACAGCCT
TCAGAATTACCACCTAAACCAGGAGAACTGCCTCCAAAGC
CTCAACTGTCCGAACTTCCCCCTAAACCCCAGTTGGGTGA
CCTACCACCTAAACCTCAGCTTAAAGATCTCCCGCCCAAG
CCCCAACTCGCAGACATCTCCCCAGCCAAACCCATAACCA
TTGAGGTCCCCCCAAAACCTTCTCCAGGAGAAGTGGCTCC
CAAGCCCCAACCTCCAGATACTCCAACAATCATTCAACAA
GGTGAACTGTCACCTCAGCCTGTGATCCAGTCTAGTGAAG
ATACCAATGGAAGTCCAACATCTGCACAGGACACACCCGT
ACCATTGCCCAGAAAAATAAATCCGATTAAGAGTAAAATG
CGAAGGGTGAAGACTATTTATGATTGCCAGGCAGACAATG
ATGATGAGCTGACTTTCGCTGAGGGTGAGGTCATTGTGGT
AACTGGTGAGGAAGATCAGGAGTGGTGGATTGGGCACATC
GAAGGACAGCCGGAGAGAAAAGGTGTATTTCCCATGTCCT
TTGTTCATATCTTATCAGATTGACTTGCATATGTTGTTTC
TCCACAACCCACTCATCGCGATACCTCTGGCTATGGGATG
CACTTGACTTAGCTGCTCAATCAACAATGCAAGATTTAAG
AAGACAAACCCACAATAAAAAACAAAACACATGATCACCT
TGTTATCGTCAGAGACAGAGTGTAAATAAAGTGTCTAAAT
TTACCACTATTATACGTACCATTTTATACAGTCTAGATGG
CACCCACTTACAAGACCAGCACTTTCCCTCCACTATTACT
GAATCGCTGTATATAGGATTGTACATAAATGTGTGTATTT
CACACAAGGATGACCGTGTGATTTTGTGCAAATGTAGAAA
CTTATGTTGGTCTGAAAAGTGAATGTGTGAACTTATGCTC
TACCTGCCACTAAGAGGCGCTGGGCCAGTTTTGTTCAAAT
AAGTTGAAGTATTAATGTGGCCATTGTTGCTATAATCTAT
AGCAGGGACAGACAGAAGTTGAATTCTTTTCCTGGTGAAA
TAACTGGACTTTTAGGTTTCCTAAACTGTAGTATTTTTTT
TTTTTAAACCTACACCTTTCATAACACCACTAAAGCATGT
CCAAGAGTG

asap1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA asap1b-001 4009
asap1b-002 (1) 669
asap1b-003 (1) 1048
ncRNA asap1b-004 (1) 821
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asap1b-001 Contained in:
OTHER asap1b-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044394 (1)
  • Ensembl_Trans:ENSDART00000145466 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EL649230 (1) 914bp
    GenBank:EV758001 (1) 909bp
    GenBank:CN504384 (1) 881bp
    GenBank:EB961728 (1) 576bp
    GenBank:CB363740 (1) 554bp
    GenBank:BM184891 (1) 497bp
    CITATIONS (2)