Transcript

apba1b-002

ID
ZDB-TSCRIPT-091110-192
Name
apba1b-002
Previous Names
  • apba1-002
  • ch211-155e13.2-002
  • dkey-235d18.8-001
  • ottdart00000043257
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043257 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043257|OTTDARG00000031108|ZDB-GENE-070925-3 apba1b|no_translation CH211-155E13.2-002 LG_ BX629350.6 Danio rerio protein_coding NOVEL, 872 bp
ATATAACAAGACTATTGGCTAACATTCAGTGAATTTAGCC
ATAGACAGAGTGGTTTACTTCTAGAATGATCGATAACCAT
TGACTTCCATAGTATTTTTTCCACCGTTTTAAGGAAGTCA
ATGCTGACCCTCGACTGTTCTGATACCAGCATGTCCTGTG
AGCCCTGCCTCTTTGTTTGTGTCAGGTGTACATCGAGAAG
CAGAAGGGGGAGATTCTGGGTGTGGTGATTGTGGAGTCTG
GCTGGGGCTCCATCCTGCCCACCGTCATCATCGCCAGCCT
GATGCACGGTGGACCCGCAGCCAAATCCGGAAGACTCAAC
ATCGGAGATCAAATCATGACCGTCAACGGCACCAGTTTGG
TCGGACTGCCGCTCTCCACCTGCCAGAGCATCATTAAAGG
TCTCAAGTCTCAATCCAGGATCAAGATGAACATCGTCAGG
TGTCCTCCTGTGACCATGGTGCTCATTCGCAGACCAGACC
TTCGCTATCAGCTGGGCTTCAGTGTACAGAATGGCATTAT
CTGCAGCCTCATGCGAGGGGGGATTGCGGAGAGAGGAGGC
GTTCGTGTCGGTCATCGGATCATCGAGATCAATGGTCAGA
GTGTCGTGGCCACACCACACGAGAAGATCGTCCACATCCT
GTCAAACGCTGTCGGAGAGATCCATATGAAGACGATGCCG
GCCGCCATGTACCGTCTGCTCACGGCCCAGGAACAGCCTG
TCTACATCTGAACCATCTACCTGATCCAGAGTTCTTATTA
TTTATAGAGATATTAATATAACTGTTTACAGATTTATTTA
ACTGGATGTACGTATTTATTATTCCATTACTAGTGCATAA
AGCAAAAACCATTCCAGCCACATGTGACCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations