Transcript

apba1b-203

ID
ZDB-TSCRIPT-091110-1648
Name
apba1b-203
Previous Names
  • apba1-001
  • apba1b-001
  • wnt11r-001
  • ch211-155e13.2-001
  • ottdart00000043256
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043256 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043256|OTTDARG00000031108|ZDB-GENE-070925-3 apba1b|OTTDARP00000034291 CH211-155E13.2-001 LG_ BX629350.6 Danio rerio protein_coding NOVEL, 3335 bp
ACTGTTGATAAGAACAACCGACGGAGATGAAGGCGAGCCG
AGCAGGCTTTCTCCAGCGATGCTTTTCATAACAGGCAGTT
CAGCAGCATCTAGACAATGAGCAGTGAGTGGGTGGAGCCA
TGAGCCATAGGGAGGAGCCAGAGGAGGCAGGCCTCAGAGG
ACCTCCCCCTCATCGCAGCAAGCAGCCCAATGGGACTCCT
TTAGAGGGGGGCCGTCCCAGATGGAGGCCATGCCAGCTGC
ACAATCCCGATGCAGAAAGCCAAGGCCAGCACCATCATCA
CTATCATCACCAAGCCCACCAGCATGCGTCTGGATCTAGT
CGAGCTCCACCACGTCATCGTAGGCGGCATGTTCCTGGTC
AAGCACAACGCAGGCGGCCCGAGAGTGGAGATTCAGAAGC
TAGAGCTGGCCAGCAACCCAAACCGGGGGCGTCAAAACAC
CATCGAAGTGGAGAGAGACTCTATCAGCACAGATACAGAC
AACAGCACAAAGATGAAGAACAACATGTCAAAACTCCTCC
AAAAGAGCAAGCTTCAGAGCCATTGTTATCTCCAGATGAT
TCTTCTCAAGACTTGCTGACCCCTTCTCCTCAGGATGAAC
CAGTCACTGACGAACTGGATGAGAGCAGTCCAGATTTGTC
CCATTCATCTGATACACAGATTAATCGTGATCCAGAACAA
GAACAGGCAGAGTCTTCAGTGGATCAGCCGGAGGAGAATG
TCCACCGTGAAGAATTCAAGAATCCATGTGAAGAGGAATT
AGTAAAAGTGAACGAAGTTGAGGACTTATCCACACAGATT
CCTGAGGAAGATTATGTCCCACCTAAGATTGCTTCAAAAA
GTCGACCTGAAAGTAAAAGAACTAGTCCTCTACGAGTAGA
TGTCCCACCATTTGCCACATCTCCTCACCAGATTATCAAC
AAACCTTTTTTTCAGTCTCCACGAAGCTTCCCTGAGAGTC
TTCGAAGGTACAATTCTGATCCGAAGTCATACCCTACCTT
TTTCAACAATAATTATGCTTGTACAAGAAATGATAAAGAG
TTTGATAGTCCTAGATCCCACGATGAAGGTGACCTCTCAG
ACTCTGAAGCCTATACAGATTCTTACCCAGAGTCTCATCC
TAAAGACACAGAAACAGACCTTAACCCAGCCTTTGAAGAA
CCTCAAGCATATGAGATGAACTACAGCATGTCAATGGATG
AATGCGATGACCAGCAGGATCTAGAGGAAGAGCCTAATCC
ACATAGTGCAGTGGGCTCCAGACTCCACCACTACGATGAG
CAATCAGGAGATGAAGCTGAAAGTTTCGGCAGAAGCAGAG
CCCATCTCAGGAAGACATCAAGCTCAACTAGCCTTCCATT
GGAAGTTCATCCCCAAGATGACGAGACATCAGAAATGACT
CAAAATTCAACAGACTTGCAGGAAGAAGTTGAGGACGTAC
CTGAAAAGCAAGATCAAATAACTGAGTCTTGCAAAGCTAC
GGGCGACGCTGTGTCTTTGGCCATCAGGGATATTAAGGAA
GCCATCGAAGAGGTGAAGACCAAGACTGTGCGTTCACCCT
ACATGCCTGACAAGATCACTGAGCCGGTGTGGGTGATGAG
ACAAGACGTGAGCCCTGTTGAGGAGAGCCATCCTCAGATT
CACTCATACCCACAATCTCCATGCCAGATATCGCAGTCTT
CTCCACAGTATGCGGCTCCAATTCAAGATGCTGAACCTCC
TTTAGGAGCAGAATCCTCTGGAGTGCTTCATCAGGACCAG
GATCAGGAGCTCTGTCCTAATGTGCCAAGTGAAGAGCAAA
GGAAAAGTTTGGCCTCTTTTCCTACATATGTGGATGTTCC
TGGCCCTTGTGATCCTGAAGATTTGATCGACGGCATCATT
TTTGCTGCAAACTACCTGGGTTCCACCCAACTGCTGTCAG
AGAGAACGCCCACAAAGAGCGCCCGCATGCAGCAAGCCCA
GGAGGCCATGAGCCGCGTCCGGCAGGGCACTGAGAGTGGG
CCGCCGTCCTGCACAGAAGTGGACCTCTTCATTTCAACAC
AGAGGATCAAAGTGCTCAGCGCTTACACACAGGACACCAT
GATGGACCATCCTCTGAGGACCATCTCGTACATCGCAGAC
ATCGGGAACATGGTTGTGCTGATGGCTCGCAGGAAGATGA
TCCGCTCTCAAAGCGCACAGGAAAACCTGGACACCGCCGA
GACGCAACACACAAACCCAGCTCGAGACGACCGGCGCCAG
TACAAGATGATCTGCCATGTCTTCGAGTCAGAAGATGCTC
AGCTGATCGCTCAGTCCATCGGCCAGGCCTTCAGTGTGGC
GTATCAGGAGTTTCTGAGGGCCAATGGCATCGATCCAGAA
GACCTGAGCCAGAGAGAGTACAGCGACCTGCTCAACACTC
AGGACATGTACAACGACGACCTCATTCACTTCTCCAAGTC
TGAAAACTGCAGAGATGTGTACATCGAGAAGCAGAAGGGG
GAGATTCTGGGTGTGGTGATTGTGGAGTCTGGCTGGGGCT
CCATCCTGCCCACCGTCATCATCGCCAGCCTGATGCACGG
TGGACCCGCAGCCAAATCCGGAAGACTCAACATCGGAGAT
CAAATCATGACCGTCAACGGCACCAGTTTGGTCGGACTGC
CGCTCTCCACCTGCCAGAGCATCATTAAAGGTCTCAAGTC
TCAATCCAGGATCAAGATGAACATCGTCAGGTGTCCTCCT
GTGACCATGGTGCTCATTCGCAGACCAGACCTTCGCTATC
AGCTGGGCTTCAGTGTACAGAATGGCATTATCTGCAGCCT
CATGCGAGGGGGGATTGCGGAGAGAGGAGGCGTTCGTGTC
GGTCATCGGATCATCGAGATCAATGGTCAGAGTGTCGTGG
CCACACCACACGAGAAGATCGTCCACATCCTGTCAAACGC
TGTCGGAGAGATCCATATGAAGACGATGCCGGCCGCCATG
TACCGTCTGCTCACGGCCCAGGAACAGCCTGTCTACATCT
GAACCATCTACCTGATCCAGAGTTCTTATTATTTATAGAG
ATATTAATATAACTGTTTACAGATTTATTTAACTGGATGT
ACGTATTTATTATTCCATTACTAGTGCATAAAGCAAAAAC
CATTCCAGCCACATGTGACCTGCCTTAATCTCTATGGGTC
TGCGATGATCTCATCATTTCACCGGCATCAGTTCAACGCG
TTCAGACGTACCAAAGAGACACGAATGATGACATGGACCT
ACATTACAAGAGATCAACGGCATTAACATTAGTGTAACCA
ATAACATGTGCATCTGCTGTCATAATTCAAAGTAAAGGAA
TCAATGAATTAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations