ZFIN ID: ZDB-TSCRIPT-091110-1868
Transcript Name: amot-202
Previous Names: amot-001, traf4b-001, dkey-13f9.6-001, si:dkey-13f9.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044080 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044080|OTTDARG00000031644|ZDB-GENE-030131-7487 amot|OTTDARP00000034912 DKEY-13F9.6-001 LG_ BX842703.3 Danio rerio protein_coding NOVEL, 2230 bp
ACAGTTGACCAGCTCAGAAAATGACACTCAGAAGAGGGAA
GAAAAGTGCAGAGATTGTTGGAAAGTCTTCTCGTGTTGAC
ACGTTTTAAGTTTTGTGAAGTGTTTTCGACGCTTTGGCTT
GAACCGAAAAAACGTGTAAAGGACTTAAAACGCACAAACC
CGGCGGCAGACCGAAATAAAGCGGAACTTATTGAAAACCT
GCGAAGAGTGGCTTGGCGTTCAGGACCTCGCCGACCGGCC
GTGTGTTTTGGAGCAACTCGAGGAGCTTCTTCAGAGCAGC
AACCAGAGTGAATCTCAGGACCATGAGCAGACAGTTGTAA
CATACGAAAGCAGCTACATCAGCCACACAGGGAGTGTGGA
TCGTGCCCGAAGCTCCTCCTTCCATGAGGTGGGTAGGTCA
CGAGATCTGGAAATGAGGGCAGCAGCCTCAGTTTCCGAGG
ACACATCGGCTAACAACAGCGGTGGGAGTGGACACACGGT
TCTGCAGCGGCTCTTGCAGGAACAAATGCGCTATGGCGAG
GGTCGAAATTACCTTGCCTTGCAACAACAGCAGCAGCAAG
GTCCAGTAAGCGGATACCCAGGGCCTGGCAGCCCAGCAGA
CGAGCACTCGATGGTCCCACACATTGCGCGACAAGAGCCT
CAGGGCCAGGAGTTGCAAGTTGACAGTGGCATGGAGAAGC
TCAGCACACGCACTGCAGGAGGAGGCGGTGGTAGCGGAGG
CACCGGGTCACTTGGTGGTAGTTGTGTCAGTGGGCAGATG
CAGAATCCAGAAGACCTGCCCACTTATGACCAAGCCAAGG
TTCAGTCGCAGTACTTCCGTGGCCATCAACCCCAGCAGCC
TCAACCACAGATGCCCCCAACAGTGGGTGCTGCTTTTTAT
GTGACTGGAGTCACCAACTCTAAGGTGCGACCCCCAGAGG
GCAGGTCCACGGTGCAGAGAATGAATGGAGGCAAAGTACA
CCAAGATGATGGGCTCAAGGATCTAAAGCAAGGTCATGTA
CGTTCTCTCAGCGAAAGACTAATGCAGCTCTCATTGGCCA
CCAGCGGGGTCAAGGCCCATGCTCCTGTTACCAGTTCACC
ACTTTCCCCCCAGCTGCCTCCACCAGGACTTCCAGGAGAC
TACTACAAACCTACTGGGCCTCCACACAGGGGGCCACCTC
CAGACTATCCTTTTAAAGGTATGCCCTCTCCACCCAAACA
GCAACAGCACCATCAGCCTCAGCACCAGGAGCCTGGACAC
TTCCACCCAGACCACCGCGGTACAAGCCAACCAGCCAGGA
CTGACATTCCTCATGTCCGGTACCAGCCACCACCTGAGTA
CGGCTCTTTTCGGTCAAGTAAGGAGAGTTCAAGCCACTCT
CAAAGGTCCGTCCATCACCACAGCCCTTCATCTTCGGTTA
CGTCTGGAGGCTCTCTCTCCCGTGCTCAGTCTTCCACTCT
CAGCAGCATCTTGGCTGCTTCCCATGCGCTTCCACCAATG
GGTCATTCGGGAGAGCCACCCTTCCCCATAGGTGCTCGAA
GCTCACAGGGGCCTGGTTCTCACCAAGGTGATCCATACGG
CCCAGGCCATCCTCCTCATCAACGGAGCCACGTGTTTCCA
CATGATCATTATGGGTCAGCTCCAAGGGGCCTCCACATGC
TCCAGCACCAGTACCACCAACAGGGCCCCCAGCAGCAGCA
GCAACAGAGTCCAGCACAACACTACTCACATCCACTCTCC
ATGCAGGGGGATCCTTATGCCATGCTTGCCCGTGCCCAGC
AGATGGTGGATATGCTGTCTGAAGAAAACCGCTTGCTTAA
GCAAGAGCTGGAGGTGTGTGGGGAGAAAGTGTCCAAACTA
CAAAAGATGGAGACTGAGATCCAGATGGTGTCAGAAGCTT
ACGAGAACTTGGCTAAATCATCCACAAAGAGGGAAGCTCT
TGAGAAGACCATGAGAAATAAGCTGGAGATGGAGGTGCGC
AGGGTGCACGACTTCAACAGGGACCTACGAGAACGAATGG
AAACGGCCAACAAGCAGCTCGCTGCAAAAGAGTGTGAGGG
CACAGAGGACAATCGTAAAACCATCTCACAGCTTCTGGTT
CAGGTTAAAGAAAATCAACGAGAAAAGGAGAAGCTGGAAA
TCGAGTTGAATTCACTTCGTTCCACAACAGAGGACCAGCG
CAGGCACATCGAGATCCGTGACCAGGCCTTAAACAACGCG
CAAGCCAAAGTGGTCAAACTGGAGGAAGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
amot-202 Contained in:
[BAC] DKEY-13F9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000044080 (1),  Ensembl_Trans:ENSDART00000141096 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB859036 (1) 550 bp
GenBank:AL919901 (1) 228 bp
CITATIONS (3)