ZFIN ID: ZDB-TSCRIPT-091110-1860
Transcript Name: dnajc18-201
Previous Names: dkey-71d15.3-001, dnajc18-001, ottdart00000044052

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044052 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044052|OTTDARG00000031625|ZDB-GENE-030131-8019 dnajc18|OTTDARP00000034893 dnajc18-001 LG_ BX510945.14 Danio rerio protein_coding KNOWN, 2696 bp
CTTCCGATTGGCTGTTTGGATTGTAGTCCCGCATCCTTCG
CTTCTGCTTCCGGTTAGCAATGGAGGTTACAAGCAGTATT
GCATTTCTGTCTTTCTCGCACATTTTGCAATGACGAAGCC
AGGTCTGGTGTCTAGGATTAAACATGAATTGCTTTGATAA
TAAATTCATATTCGACTAGGTTGCGTCGTAGAGGTGTCCG
TTTAGTGAGCGGAGGATGCTTAAAATCGGAATTTAAATTG
TTGTGGTTGCATTAGCATAACGCACTCGATTTAGCTTCAT
GTCAACAACACCGCGAGTCATTTGTACCGTTAAATAAGCC
TCGTTTTGATTATTTAGCTACTTTGAGCTCATCGGCACGA
TATTTAATGTGGGTTTGAGGTGTCATTGCTGAACATGTCA
ATGTTTGAGATGGACAGAGAGGAGTCTGACAGGCTGATAG
AGAAAGCCAAGCTGTGTTTGCGCTCAGGACGCAAAGAGAA
AGCCCTGCAGCTGTTGTACGAGGCGCAGAAGATCTACCCG
AGCACCAGGGCCAGAGTGCTGATTGATGCCATTGTGAAGA
ATGGCTACACTCCCCCTGATGATGAGCGCACCTACACACC
TCCCCCGGGCTGGAGAAGTGCTGATGAAGATGTCCCGCCT
TCAGTTCCACATCACCGGCCCAGTACACATGAGAGAGCAG
AGGCGTCCGCCGACGACAAGAAGAGCTACACGGAGGAGCA
GCGACAAGGAGTTCTCAGGATAAAGAAATGCAGAGACTTC
TATGAGATTCTTGGAGTGCCAAAGGGCGCCAGTGATGAGG
ACCTGAAGAAAGCTTATAGGAAGCTGGCACTTCGCTTTCA
CCCGGATAAGAACTGTGCTCCTGGAGCCACTGATGCTTTT
AAAGCTATAGGCAATGCATATGCAGTGCTCAGTAACCCAG
AGAAAAGGCAGCAGTATGATGAGTATGGAGACCAGGGCCC
TGCCGAAACATCCAGTCAGCCTTCAGCCCAGCCGCGTCAA
GCATACGCACGCCATCGCTCTTTCACCAGAGACTTTGAGC
CTGACATCTCCCCCGAGGAGCTCTTCAACATTTTCTTCGG
TGGCAGGTTTCCCACAGGCAACATCCATGTGTACACTAAT
GGAGGAGCTTCTTATGCTCATTATTACCAGCCACGCAGAC
GCCGTCCATTTGAGAGACGAGAAGAGGAGGTGGAGGAGAG
CCATAGTACTAACAACTTCACCCCTCTCCTGCAGCTGTTG
CCGGTGCTGGTGCTCATTGTGATCTCTGTGTTCACTCAGC
TGATGGCCACCAACCCTCCCTACAGCCTCTTCTACAAACC
GTCCATGGGGTTAGTGGTGTCCAGGGAGACTCAGCACATG
GGTGTGCCATACTACGTGGATAAGAGTTTTGAGAAGGAGT
ACCGTGGTGCTGCCCTGGACGAGCTGGAGAAAACCATAGA
GACTGACTATATTGATCATCTACAGAGCAGCTGCTGGAAA
GAGAAGCAACAGAAATCTGATCTAGCTAACCTAGGCCAGC
TTTATCGAGACGAACGGCTGAAGCAGAAGGCAGAGACCAT
GAAGCTGGATCACTGTGACAAACTGCACCGCTTCATCGGC
CGGCAGAGAGGAGACTGAAGCTTCATCGTCCATCCAGACA
GCATGGTCAGCCTAATCAAAGAGCTTTTAGTATCAGTTAC
GGTTATATATTTCAATTTACACGGGTGGGTCACCTTTTTG
GGAAGGAGAAAGAAAGGAAATAGATGTGTTTCAGCCCAAG
CTGACTTTGTCTTGAGCGTTTGTGCCTTTAATGAGTGCGT
TGATGAGGTGAAGTCTGAAGGCCTTTAGCTCAAGCCTCTG
ATTCAGCTGCGATTGCACAAGCGTATGTGGAAGAAGGTAA
TTTTTGCACGAGCGCCTGGCATTTTTTTTCCTTATATTAA
GGAGTACCGACTCCAGGCTGGCAGATGGGATTAAAGCTAG
AGATTGTTGTTTATTAGTCGCAGTTAAGCTTTATTGTTCA
TAGGAATTTAACTTGTATAGCTCCTATTTAATTTCTTTTT
CCTGCATTTGAGCTGTGAATTACTTTTGACAAGACAATTA
TAACTTTTAAAAGGACGAAAGCTGAATTTATTAGTTTTTT
CGGGTATTTAAACCACTACAGATTTTCAAAGTACTCTAGA
CGTAGCAGAAACCCCTTGTGCACCTTAGTGTTTTGCTCAT
TTGTTCTATTGCTGTATGTTTTGGACGTTAAATGGCGATT
GTTTTAAATCAATGTTTTATTTTCATGAATATCAGCGCAC
TGACAGACATGTTGAATGCCATTACCTCTCTTATTTATTA
ACCGACAGTGTTTTATTTATAATTTGGCACTTTATTTGTC
TTAACTTAATTGTGTGTTGCATGCTTCCATTCAAGCATTC
TCCCTGCCTCGGCACAGTTATTATAACCAGGCAAATAACC
GTTACTGAGCATCTGTTTTGAATGTTTTACCTCATGTCAC
TGAACACTATGTTCTGTATATAATAACATGCTGATCTTTA
GCTCAAATCTGAAGAAGCGCTGAAGGAATTATCCTCATTC
AGGATGGAGTAGTGGACGTGATGTGGAGAGTTTGTGCCAG
TGGTATTGTTGGTGTTGTTTCCATCAGTTTGCAACTGATG
GAAGTTTTGTTTGGATTGAGTGCGTTTTGTGCCGCTTAAA
TAAAACATTAATCAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajc18-201 Contained in:
[BAC] CH211-59D17 (1)

Genome Resources: Vega_Trans:OTTDART00000044052 (1),  Ensembl_Trans:ENSDART00000101054 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154601 (1) 2590 nt
GenBank:BC171434 (1) 2498 nt
GenBank:BC171432 (1) 2497 nt
GenBank:EH553957 (1) 977 nt
GenBank:EG578694 (1) 951 nt
GenBank:EG585986 (1) 863 nt
GenBank:EE327324 (1) 845 nt
GenBank:CV489482 (1) 810 nt
GenBank:CK680618 (1) 602 nt
CITATIONS (2)