header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1825
Transcript Name: slc45a2-201
Previous Names: slc45a2-001, dkey-163i6.6-001, ottdart00000043918

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043918 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043918|OTTDARG00000031540|ZDB-GENE-050208-97 slc45a2|OTTDARP00000034808 slc45a2-001 LG_ CR749169.8 Danio rerio protein_coding KNOWN, 1745 bp
CTCAACTATGCACTAGGAATCAAGAGTCTTACCATCCAGA
ACCATGACTCTTCTTACTGAGGACCAGCCTTGCAGGTTCT
CTGCACCGGAAAGCCCAATTGCATCCATGGAGCAGTACCA
GGTGGACTCGGAGCTTAAAGAGGACTGTTTGGACAACATG
GAAGCGGCTGTTTTTGGAGTGGTGGAGCCTCCGAGGCGCT
CTAGGGGAAGGTTGATTATGCACGGGTCGGCCATGTTTGG
AAGGGAATTCTGCTACGCTGTTGAGGCTGCGTTTGTCACG
CCAGTGTTGCTGAGCGTTGGACTTCCCAGACGTCTGTACA
GTCTGGTGTGGCTCATAAGCCCCATTTTGGGTTTTATCCT
ACAGCCCGTCATCGGCTCGGCGAGCGACTACTGTAGGTCG
TCATGGGGCCGAAGGAGACCGTACATACTCTTACTGGGGA
TTCTGATGTTAGTGGGCATGACTTTATTTCTAAATGGAGA
TGCAGTCACAACAGCCATAATATCAGACAGAAATTTAAAA
AGGACATGGGCCATCGTGGTGGTGATGTTTGGAGTGGTTT
TGTTTGACTTTGCCGCAGACTTCATTGACGGACCCATTAA
AGCCTATTTGTTTGATGTGTGTTCTCATCGGGATAAAGAG
CGGGGTCTTCATTACCATGCTTTACTCACAGGTCTGGGTG
GAGCGTGTGGTTACCTGATTGGAGCCATGGACTGGGGTCA
CTCCGCTCTTGGCTCCATTCTGGGCTCTGAGTACCAAGTC
ATCTATTTCTTTTCATCTCTGACCTGGGGCATTTTTCTCA
CCACGCACCTTTTCAGCATCCCAGAGAAGCCACTGATGAA
AGAGCCCAGCTCAGATTCCTGTCCCTCCGCCTCGCTGCTC
CCTGAAGGCCCGCTTCAAAATGGCTACGGCTCCGTGTGTA
AAGAGCCAGTGTCTCTTTCTAACGTGAGGGAGCGCACCTT
CTCTGTCCTGAGTGAAGCCAACGCTGTTACGCCCAGTGCC
AAACAGCCCAACAGCGAGGTACAGAAGCGGATGACCCTGA
AATCTCTCCTGTCAGCTATGGTTAGCATGCCTAGCCATTA
CCGCTGTCTCTGCATGACTCATCTGTTGGGCTGGACGGCT
TTCCTCTGCAACATGCTCTTCTTCACTGACTTTATGGGGC
AGATTGTATATAAGGGGAATCCGTATGCTGAACACAATTC
CACTGCCTATGCCACCTATGAGAGAGGGGTTGAAGTGGGC
TGTTGGGGTCTATGCATCAACGCCGTCTCCTCTGCACTCT
ATTCATATGTGCAGAGGCTGCTTCTGCCATATATTGGCCT
GAAGGGACTGTACTTCCTTGGCTACTTTATGTTTGGTTTG
GGAACCGGTCTGATCGGCTTGTTTCCAAACATCGTGGCCA
CACTGACACTGTGCTGTGTGTTTGGAGTCATGTCCAGCAC
TCTCTACACCATCCCATTCAACCTCATCTCGGAGTACCAC
AAGGCAGAAGAGGAGCAAAGGAAATTAGGCGGAGATGGAG
TGGCTCCTGAGGGCCGCGGGACAGGGATGGACTGCGCCGC
TCTTACCTGTATGGTTCAGTTGGCTCAGGTTATTGTTGGA
GCTGGACTGGGAGCTCTGGTCAATCTAGCGGGTAGCGTGA
TTGTAGTAGTGCTTTCTGCCTCAACAGTGTCCCTAATCGG
CTGCCTCTTTATTGCTATCTTCATGTGATGTACAGAATAA
GCCTCAAATAAATACCCTTTCTCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc45a2-201 Contained in:

OTHER slc45a2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043918 (1)
  • Ensembl_Trans:ENSDART00000030887 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154627 (1) 1810 bp
    CITATIONS (2)