header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1749
Transcript Name: prlra-201
Previous Names: prlra-001, dkey-264m23.2-001, dkey-42o15.1-002, ottdart00000043617

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043617 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043617|OTTDARG00000031317|ZDB-GENE-080103-2 prlra|OTTDARP00000034577 DKEY-264M23.2-001 LG_none CR318662.11,FO393393.3 Danio rerio protein_coding NOVEL, 6237 bp
ATACTAAACAAACAAGCTTCATGAATCGCTTACAGCTGCA
TGCTTCTGCTCTCTTTAACAGCCAATCACTCAGCACAGGA
CTCCATTTGATGTTTGTTATGGATATTAAAATCTGAGGAG
TTTGGAAGTCATTAGGTGATGATGAGGATTTCCGCCGCTG
TGCTGATTTTGACCTTAATTGCAGATTTAATATCGCAAGC
AGCAGGTGTCAGTCCTCCAGGCAAACCCAGACTGACCAGC
TGTCGCTCCCCAGAGAAGGAGACCTTCACCTGCTGGTGGG
AGCCTGGAGATGATGGAGGTCTGCCCACTACATATGCCCT
CTACTACCGCCTGGAGAACACCGAGACGGTCAAAGAGTGT
CCCGATTACAAAACCGCAGGCGAGAACTCCTGTTTCTTCG
ACAAAAATGCCACATCGCTGTGGGTGAACTACAACATCAC
AGTAGTGGCCACCAATGCTTTGGGCAGGAACATTTCAGAA
CCCGTGGAGGTGGATGTCGTCTATATTGTTCAACCGAATA
CTCCGGAAAACGTCAAAGCGGTTGTGATTCACGAGGACCG
GGATCCATTCGTCAAAGTTTCCTGGGACAAACCACGGACC
GCAGACACCCGATCTGGATGGATCACACTGCATTACCAGC
TACGGGTTAAACAAGAAGAGGATAAAGAATGGGTGGAATA
TGATGCTGAAAGGCAAAAGAACTATAACGTGTTCAGCCTT
CACTCTGATAGAGAATACATGGTGCAGGTGCGGTGTAAAC
CAGATCATGGCTTCTGGAGTGAATGGACACAAACCACCTA
CGTCAAAATGCCCAACTATATTCCCAGAGAGCGTTCGTTG
TGGATCATGATCACGATTTTCTCTGTCTTCATCGTCTTTA
TCCTCACCTGGATGCTCAAAGTGAAACACAACAGTGTGAA
GCTTTGTTTGCTGCCTCCTGTTCCTGGGCCGAAAATCAAA
GGATTTGACAAACAGCTTCTCAAGAGCGGGAAATCAGAGG
AAGTTTTCAATTCTCTGGTAATCCCAGGTTTCCCTCCAAC
CACTGATTACGACGATCTACTAGTGGAGTACCTCGAGGTG
TACGACAACGAGGAGCAAGAGCTGGTCCTGGATGGTAAAG
ATCTATCAGAGGACAGCATGAAATCCAAAAGCCCATCTGA
CAGCGACTCGGGCAGGGGCAGCTGCGACAGTCGTACCCTG
CTTTTAGACAAGTGCATGGAAGGAAGTGGAAATGACCAAC
ACAACTACAGCCAGCACGGAGAAACAAGCTGGGCTTCTTC
CAGCGAATGTAGCGAAAGCCAAGGTTCACCTGGTTCTCCA
GAGTCCACCGATGGACGCATGAAAACCTGGCCTGTTGTGT
TTTCCTCACCCCAACCGCATCACCACTACCAAGTCGGAGC
GACAAAACCGGCCTACCACAGCGTCCCGGAGATCCTAAAA
CATTCACCATCACACGCAATCCCAAGCAACTACCACCAGC
TTTACCTTCAGGACATCCCGCCGCAGGAAGGGCGCTTTAC
TAAACCTCCCTGCCGGCATTCCCAAAGCTACAACCAGTTC
AACATGGACAACGTTGACATTTCCGAAGCCGGTGTTCCTC
CATCTCGCTCCTTGGAGTATGTAGAGGTGCAGAGGGTCAA
CCCGGAAAACATACTACTGCTTAGGCCACTTTCAGACCCA
AACCGTGAACCTGAAGGGTCAGATCGCATCGATGAGGACT
ACAGCAAGGTCAAAGAAGTGACGTCAAACAATACTCTCCT
TCTCCAAAGAGAAACGTCTCATCAGGTTGTCAATGATTAC
AGCCAGGACTTTGAAAGCTATGCTGATCAATGCACAGCCC
AGCAAACTCCTCACCCATGCAAACCTGTCATGACACAGTT
GCACAGTCAAGACATGAGGGTGATGGGAAACGGTTACGTG
GACACAACAGTCCTGATGCCATTATACAAGCAATTCTAAC
GCAGGAAGGCTGACAGACAGTCAAAACAAACAAAAAAAGC
AGACAAAACATATTAAAAACAACTGTTGACAGCTCATGCC
AAGCGCTTTTATCCCTCTCAGATCTTGTTATGTTTGATAA
ATAAGCAGGATTTGTATTTATACAAGTGATATTTACTTTG
AAGTAGATTGTATCGGACACAAGCTGGAGGGTTGCTGTGA
ACTTTTACATGAAGAAGTCACGGATTATGTACTTTTATGA
GGTGATGCTTGTAAACCACCAAAAGGGGTTCGCTTTACAC
TTATAAATAATTGAAGTCTTTAAAGTTAACATGAAATCGA
AGCAGGTCTTATTATCTTAAATGCTCGGATCACCCAAAAG
ATTTTACTTTTATTATTAATTACTCACCCGCATGTTGTTC
TGGACCTTTGAGACATGTCTTCAGAACACAAATTTAAGAT
ATTTTAGGTGAAATCTGAGAGCTCCCTCATCCTCCATAGA
CAACAAAGTTCCAGACTTGTTCAAAGTAATAAAACATACT
GTGGAATATTTAGTCAATTCCATGCGTGTTCAGTAAAAAA
GCTCAGGAGAGGTTTTTCTTCAATGTTACACATATTACTA
ATTTATTAGATACAAATAAAAAATTCGATTCACAAAATTT
GGTTATCCTCAATGCAATGCAAGCGTGCTTTTATGCATAG
CTGATATTAACAGGATTGACATCACTTGTCAATCAATCTC
CAGTCCTTCTTTGGCCGCACCCATACATACGTCCTCTTTT
TGTACTAATTCTCTGCACAGCACCAAAAAGCACAAGACTT
ATCAACTGCAAATTCTGTTCTCACAGGAAGTTTCACTGCA
GAGCTCAAGTTAATTTTAGACACTCAGGCCTTTGCATTCT
AGCAGCTACTTCTGCAAAAATGCTTCATTATTATGCAAAA
CATATCAAAGAAGTTGGTTTATATTTATCACCTTAAGCAA
TACAAATACAATTGTTTAGTGAAAAGAGAAACAGACAAAA
CTAATTTAATAATTAATTCCTTTTTTTACAACAGTACAAA
ATGAACATCCTCAAAACAGTTTATATTGCCTTTAATTGTG
CAATTGGAAAATTATCAAGCTAGGGGAATATTTTTGTGTG
CACATAGCACAAAAATAATGTTTTTATTTAAGTTTCTTCT
CCTCATTCTCAGTATATTGTGCATGTTTACAGGCACTGTG
TACTGATATATACTCTGAATTCAGCTTGTTTGAAATGTAG
CGTAGCATCACAGGTAATATAGCAGCTCGATATTCAGCTT
TTATACGTAGCTGATATTAACAGGTGGAGTTTAGTGGAAT
TCATCACCTGTCAATCAGTTTCCATTCAGTTTCCAGTCCT
CCATTGGCCGCACCCATACATACATCCTCTTTTTCCACTA
ATTCTCTGCACAAAGTCAAAAAGCACAAGACTTCATGCTT
ACAGGAATTTTCGCTGCAGAGCTCAAGTAATTTTAAACAC
TCAGGCCTTTGCATTTTTAGCAGCTTCATCTACTTCTGCA
AAAATGCTTTATTCGTATGCAAAACGTATCACACTAGGGA
AAAAGTTTGGGTAATTTATTTCACCTTAAGCAATACAAAT
ACAATTGTTTAATGAAGAAAAAAAGAGACAAAAATGATTT
TAAAAAAATCCTCAAAACAGATCATATTGCCTTCAGTGGT
GCAATCGGACTATTATCAAGCTAGGAGAATACTTTTGTAT
GTACAGAAAAAATGACTTAATTGTACAATTTCTTCTCCTC
AGTGTCAGTATATTGTGCATGCTCACAGGCACTGTGTACT
GATATATACCCTAGATTCGGCTTACATGGTTTGAAACAAA
GCGGAGCATCACATGTAATCCATCAGCTCAATATTCAGCT
TTCTCCTGAACGCGCACAATATACTGACACTGTGGAGAAG
TGTTCTTTATAACGAGTCGGGACCGTTGCTGTTTATGAAG
GATGAGCAAGAGCTCAGATTTCATCTAAATACCTTAAATT
GTGTTTCGAAGGAAAACAAAGGGCTTAGAGGTTTGGAACA
AAGTGAGGGTGAGTAATTAATAACGGAAGTGTCATCAACT
AACACTTTAAATACATATGCTTTTTTGTTAACCAATAGCC
AAAAGTTATTCAGGCACGATCTAAGACTTCTTTTCAGAGT
TTGCAAATTGAAATTGCACCTAAGTTGTTTGTGTTTTAGG
TTGCATTTACACAATTGTTTCCCAACCCTGTTCCTGGAGG
CACACCAACAGTACATATTTTGGATGTCTCCCTTAAATAA
CCCATTGATTTCAGGTTTTGGAGTCTCTTCTAGTGTTCTA
ATGAGTTGATTCAGGTGTGTTTGATTAGGAGAGGTTAAAA
ATGTTTACTGTTGGTTAAAAATGTTTACTGTTGGTGCGCT
TTTAGGAACAGTGTTGGGAAACACAGATTTACACAAAAAT
TAATATAAGTTTCACATTCAGATGACAATACTGTCAAATG
TTTGTATAATGTGTCCTGTTTTTTATAATCGTGTTTTTAA
AGTTATATTGACTATTTATTTTTACAGTGTTTGTTTTAGG
CTCCTAAGGCCTTGTCAAGCAAAATTGCATAATCTTTTCC
TTTTTATTTTTAGTTGCAAACGGTATTGTGTAAACACTCC
CTTATTTAAGGAAAATAAGACGCGAATACTATTTCATGTT
AACTTCAAACGATTTGTCATGTTTATATATTCCTGAGATT
TGAAAACTTAGCACTTAGCATAGTTGCCATCGGCAGTTCA
CTATGCATTATGTTATTGTATGTATTTTTGCATCATGGCA
CTGTTACGTGTTCAAAGCTACAATGCTTTTTATCCCACTG
TTCACTCCCGAAACGCATAAAGGTCTAAAAACTATTTTTA
ATGAACTAATCTTGAGAATTGTAACAGCATTCAGCCAATT
CAAAGCTTTGGTTTGATGCACTGCACTCTACAATGAATTT
TAATGCTCCAACATGCCTACTATATAAATACAATATCATT
TTTGTCGCCAGTTTAATCCTACGTAATCTTTCATTTCAGG
AAACATTTCCGCTTGTGAAATCTCAGTCATACAATTGAAA
ATGACTTCGTATATATTAATTGAACACTAATGCACATACG
TTAAAAGGGATTTGAATTGATTGTAAATTGTTTTTAAATA
TATATTTTTAGCTCTCAGGTGGAGGTAAACTCACTTAAAT
GATCCTGCTGAATGTATAAATGTATTATAAATGTATTTGG
CACTGATTTTGGCACAAAATGAGAAAGTGCCAGCATTTAA
GTACATTTCCAAATATGTTTCAGTGAGTTATTCGCTGTAG
AAGTTGAATGTTAACCCTGTGGAAAAACCTTTCAAATGAC
ACGCATAGCCATTTATTTAGCACTATTTTTTTCCTTATTC
TTTCATATAAAAGAGAAATTATAAAAAATATATTTTAAGC
CTAAAAAGATCAGACATTATATGAAACAACCAGGCAGTTA
TTATCTTGCATGCACAAAATGTTAACCATAAAAGCAGTTG
CTTGCAGAAAAGAATGAATTTTGCAAGAGTCAGCCTCCAC
ATGTTGCCTTATTTTATGCTTGAATCTATGAGAGAAGACT
GTGTTGATTTTTTGGACAGTAAATTTGCAAATACATACAC
GCATGTATATAAAAACAGTACATTCGGTTGTTATAAATGA
CACATAGAAACCTAGATCATTTATACAACAGTTTAATTTT
GTAAGGGTCGACTGAGCCTAAAAAAAATCCTGATCTAATT
TAGTTTAATTGTGAGTAGAGTAATATTTTCTTATGTCTTT
GTTTCTTCAACAGTCTTGTTTCATGCATAATAAATCTGCA
TGCATCATTTATGTTAAGCAATTTTTAAAATCAGGCAATG
GAAAATAGGTTTTTGTAACCGGATTTAAAGACAATTGTGT
GAAATAATACTTTCATTTGAGCGTATGACGGAACATAAAT
CCCAAGGATGATTATATTATCACTTGATTTCAGTTTACCA
AACTTAAAACCACTATAATCAGCCTTTGCTATATTATAAA
GATACACTAAAGAATGCTATATTTTTGTTGACATGATGCT
ATTTTTATTTAATGTCTTTACTTTTGTTGGGTGAATTCAA
GTCAGTTGAGGTGCTGAAATCAAACTTGTGCTGTTGACCT
ATGTAAGTTGACTGAAAACATCTTGTGTAATGTATCCTTA
TTGTGTTCTGCTTTTCCATAACCAACATTACTTGTCAAAT
CACATAGCAAAACCATTAAAACACTTGCTCAGATTGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prlra-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043617 (1),  Ensembl_Trans:ENSDART00000128859 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EU517718 (1) 2068 bp
GenBank:EU517719 (1) 2010 bp
GenBank:BC163005 (1) 1995 bp
GenBank:BC163012 (1) 1995 bp
GenBank:EH996518 (1) 1054 bp
GenBank:CN324502 (1) 881 bp
GenBank:CN505437 (1) 854 bp
GenBank:DT879348 (1) 686 bp
GenBank:EB942263 (1) 682 bp
GenBank:CD597685 (1) 650 bp
GenBank:CD599082 (1) 650 bp
CITATIONS (2)