Transcript

slc25a1a-201

ID
ZDB-TSCRIPT-091110-1616
Name
slc25a1a-201
Previous Names
  • ch211-287a12.4-005
  • dkey-175g6.3-001
  • slc25a1-001
  • slc25a1a-001
  • ottdart00000043144
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000043144 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043144|OTTDARG00000031030|ZDB-GENE-040426-1172 slc25a1a|OTTDARP00000034212 DKEY-175G6.3-001 LG_ CR926463.9 Danio rerio protein_coding NOVEL, 1909 bp
CACGCCCCGGAGTGGTCTTCCTCTGATAGCGCGATTGTGT
TGTCTCCGTCCGATTGGACAGACGCATCCAGCGCGGCGGC
ACACACTACAGATTTCCACACTGTACGCTCAAAACATCAG
CAAACATGTCGTCTTTGTATAAACCGTTTTGTGTTTCGGA
AGGGCCGTGCAAAGATGCGATACTGAGACGAGGATGCGCG
CCGCTACAGCATCCTGCGGCGCCGACCCGGATTCCCTCCC
CTGGCGGTGGCTCGACGCGCACTTTTACCCCAATTCCTAA
CATTTATCCGGGCCAAAGGACTCTAGCGGCCGCTGCCATC
GGAGGAAGAAAGATCACGCATCCGTGGAAGGCTATTTTCG
CAGGTGGCATTGCAGGAGGCATTGAGATCTGCATCACATT
CCCCACGGAGTATGTGAAGACCCAGCTACAGTTAGACGAG
CGAGCCAATCCTCCTCGATACAGAGGCATTGGTGACTGTG
TTAAGCTGACGGTGCAGTATCATGGCTTGAGAGGTCTGTA
CAGAGGGCTTAGTTCACTGCTTTATGGGTCCATCCCAAAA
TCTGCAGTACGGTTTGGGACATTCGAGGTTTTGAGTAACC
CAATGCGGGACGCCACGGGTCGGCTTGATAATAAAGCAAG
TTTGCTGTGTGGACTCGGAGCAGGAATTGCAGAGGCGGTG
TTGGTGGTTTGTCCAATGGAAACAGTTAAGGTGAAGTTCA
TTCATGACCAGTGCTCTCTGAGGCCACGTTATCGAGGGTT
TTTTCATGGCGTAAGGGAAATCATTAGAGATCAAGGTGTT
CGAGGGACATATCAAGGCCTGACTGCTACACTTCTGAAGC
AGGGTAGCAACCAAGCGATACGCTTTTATGTTATGAATTT
GTTGCGGAATTGGTACAAAGGTGATGACCCTGCTCGTGAC
ATGCACCCACTGGTTACTGCCATGTTTGGAGCAACAGCAG
GAGCAGCGAGTGTTTTTGGGAACACACCACTTGATGTGGT
GAAGACTCGGATGCAGGGATTGGAGGCTCATCGCTACAAG
AGCACGATGGATTGTGCATTCCAGATTTTGAAGAATGAAG
GCCCGCTAGCGTTCTACAAAGGCACAGTTCCTAGACTGGG
CCGAGTGTGTTTAGACGTGGCCATTGTCTTTGTTCTGTAC
GAGGAGGTTGTGAAGCTACTCAACAACGTCTGGAGAACAG
ACTGAAGATGAACAAATGCGCAGACAGAGACTGAACTATC
CAAACACAGTCGGCCATGTCAGTCAAGTCTAAGATCCAGA
CTTTGAACCGTGACCTCTGGCCCAGTGGATTTAATCCATC
CATCTGTGTCTGTATAGTTGAAGCCAGGAGCTTGAGCCAT
GAGAACGAACCATGTAGCTTACACTATATTTATTTGCGCA
CAAAAACATACAGAGCGTGTCATCAGTTTGCACTCGTCAG
TACAATCGTGCAAGTGTCTTCTTTCTCACCAACATGCTTT
TTATAGAGGAAGTCGTGAGATAGTTGATGTATGTGGCATG
AAAACTAGCACAACCAAATCCGCAGAAACATTGAAGTATT
AATGTAACGCACATGTTCCTTTGTCTTAGTTTACACTGGA
AACAATGGTATTGTGCTTTGATATATCTTGATGTTACACA
TCTCATGCCCAGTCATTCGTGTCCATATAAAAGTTGCATG
CACGAATGGCATCATCAAGACAAGGTCAGATTTATGTTTT
GTGTTCCTTTTGTTTTATAAAATAAAATGGCAGCTTTTTA
TTAGTAGCTCAATTTTTTATAAGCTTTTTATGTCATTGAT
TTCGCACAAAGGATGCCTATTCTGTACGAGTTGCGCTATT
TTTGTCTGTCTGATATGTATGCTTCAAAACTGAATACGTC
ACACAGATTTAATAAACCAAATAGGTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations