header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1403
Transcript Name: pold1-201
Previous Names: pold1-002, ch211-272f3.4-002, ottdart00000045329

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045329 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045329|OTTDARG00000019271|ZDB-GENE-060429-1 pold1|OTTDARP00000048019 pold1-002 LG_none CR847509.9,CT573471.12 Danio rerio protein_coding KNOWN, 3561 bp
GCTCGTGTCCGGTGGAAACTGACGTTCAACTCAGTGAAGT
GGCGGGAGATTTATGAAGCACATACATGGAGTATTAGAGC
TCGAGCTGGATTAAAAGAGCTGCTTAAAAATGGATTTTAA
AAGGCGCAATGGGGGCCCTGCAATGGGCGGGGCTTCACAG
GCCAAAAAAGGCAAGCCTAGCACAGAGTGGGAGGATAGCC
CCTCCCAGTTTGAAGAGGAACTTGCATTATTTGATGAAAT
GGACATGGAGGTGGAGTCAGGGGAGGGGCAAGCTGGTCAT
GACGTCATCCCAGTAGGTGATTTATTCTCCACTGATCTGA
ATCCACGCTGGAAAAGGCCTCATGCTTCGCCTCTTCATCC
AAAATCAGACACGCTCATCTTCCAGCAGATAGACCTGGAT
TACTACTTGGGAGCGGCGGTAGCAGGAATGCCTGGGCAGG
TTCAGGGCAAAGTGCCCATAGTGCGCATGTTTGGTGTGAC
CGACAATGGGAATAGTGTGTGTTGCCATATTCATGGATTC
GCCCCATATTTCTATGTTCCTGCCCCTAACGGGTTTACGA
ATGCACACTTGGCTGACTTTCAGAGAGAGCTGAATTCTGT
GGTGTTGAAGGACATGCGCTCCAATAAAGACAACATAGCA
GTCACTGTGCTGGCAGTGGACATCACCAAGAAAGAAAGTA
TGTATAATTACCATGGAAACAAACCTCATGACTTCCTGCG
CATCACCATGGCCATGCCACGTCTGGTCGCCCCAGCGAAG
CGTCTCCTGGAGCAGGGTTTTAAATTTGCCAACTTCGCCA
CTCAGAGCTACCAGGCCTTTGAAGCAAACATCGACTTCGA
GATCAGGTTCATGGTAGACAGCAATGTGGTTGGTTGCTGC
TGGATTGAGCTTCCTAAAGGGAAATACCAGCTGAGGGAGG
AGAGGAGGGAAGGACAGACTGACTCTAAATATCCGGGAAA
GGTTTCCTTGTGTCAGTATGAGGTGGACGTGGCGTGGGAC
AGTCTGATCAGTCATCCCGCTGAAGGAGAATGGCAGAGAA
TCGCTCCACTCAGAGTCCTCAGCTTTGATATCGAGTGTGC
TGGCAGAAAAGGTGTGTTTCCGGAGCCGGAGGTCGACCCT
GTGATTCAGATCGCCTCTATGGTGCAGCGTCAGGGAGAGA
AGGAACCGTTTATTCGGACAGTCTTCACCTTGCAGAGCTG
TGCCAGTATAGTGGGCTCTCAGATTCTCTGCTTCACCCAG
GAGAAACTAATGCTGCAGAGTTGGGCTGAGTTCATGAGGA
CTGTGGACCCTGACATCATCACTGGCTACAATATCCAAAA
CTTTGACCTTCCATATCTCCTCAACAGAGCTGCAACCTTA
AAGGTGAATATGTTCCCGTATCTGGGCCGTGTGTGGGGCT
GTAAATCAGTTCTGAAGGACTCCAGCTTCCAGAGCAAGCA
GATGGGCCGCAGAGAGAACAAAACCATCAATATGGAGGGA
CGTGTGCAGTTTGACCTGCTGCAGGTGCTGCTCAGGGATT
ACAAACTGCGCTCTTACACACTAAACGCCGTCAGTTTCCA
TTTTCTGCAGGAGCAGAAGGAGGATGTGCAGCATTCGATC
ATCACAGACCTACAGAATGGGAATGAGCAGACACGCAGGC
GTTTGGCCGTATACTGTCTGAAGGATGCGTATCTGCCCCT
GCGTTTGCTGCAGAAGTTGATGTGTGTCATTAACTACATG
GAAATGGCCAGAGTCACCGGAGTTCCCCTGACGTACCTGC
TTTCTCGCGGACAGCAGATTAAAGTGGTTTCACAGCTCCT
CAGACAGGCTATGAAGCAGGATCTGGTGATGCCGGTGGTG
AAGACTGAGGGAGGGGAGGACTACACCGGAGCCACTGTCA
TTGAACCAGAGAAAGGGTATTACAGTGTTCCTATAGCAAC
TCTGGATTTCTCCTCTCTGTATCCCTCCATCATGATGGCT
CATAACTTATGTTACACTACACTCCTGCAGAAGAGCCAGA
TTGAAAAACTGGGTTTGGGTCCAGATGATTTTATCAAGAC
CCCCACCGGTGATTTGTTTGTAAAGAGCTCAGTGAGAAAA
GGTCTTCTCCCTGAGATCCTGGAAAACCTGCTGAGCGCCA
GGAAAAGGGCAAAGGCAGAGCTGAAGAAAGAGACGGACCC
CTTTAAAAAGCAGGTGCTGGACGGAAGGCAGTTGGCTTTG
AAGATCAGCGCAAACTCAGTGTACGGCTTCACCGGGGCTC
AGGTCGGCAAACTGCCCTGTCTGGAGATCTCACAGAGCGT
CACAGGCTTTGGCCGGCAGATGATTGAACAGACCAAACAG
CTCGTGGAATCAAGATACACACTAGATAATGGCTACCAGG
CCGATGCAAAGGTCATCTATGGAGACACAGACTCTGTGAT
GGTGAAACTGGGTGTTGCAACTGTGCAGGAAGCAATGAAT
CAGGGAAAGGAGGCTGCTGAATGGGTCTCCTCCCACTTCG
TTCCACCAATTAAATTAGAATTTGAGAAGGTGTATTACCC
GTATCTGTTAATTAATAAAAAGCGGTACGCCGGGCTGTAT
TTCTCCTCCAGTGCTGAACATCATGATAAGATGGACTGCA
AAGGAATAGAGACCGTGAGGCGAGACAACTGCCCTCTAGT
GGCCAACCTCATCAACACATGCCTCCAAAACATCCTCATT
GACAGAGACCCCGACGGAGCAGTAACTCATGCTAAAGAGG
TGATCTCAGACCTTCTGTGCAACCGCATTGACATCAGTCA
GCTGGTCATTACTAAGGAGCTCACGCGCACAGCACAGGAG
TATGCAGGAAAACAGGCCCACGTCGAACTAGCTGAGAGGA
TGCGTAAGCGGGATGCCGGTAGTGCTCCAAATCTCGGAGA
TCGAGTGCCGTACGTCATCATCAAAGCAGCAAAGGGAGTT
GCGGCGTATATGAAATCAGAGGACCCCATCTATGTGCTGG
AGAACAACATCCCTATAGACACGCAGTACTACCTGGAGCA
GCAGCTCTCCAAACCATTACTGCGCATCTTCGAGCCCATT
CTGGGGGAGAGCAAAGCTGAGAGTGTGTTACTGAAGGGAG
ATCACACCCGCTGTAAGACGGTCTTGACCTCCCGAGTCGG
TGGTCTCATGGCTTTCGCTCAGAAACGAAGCACTTGCATC
GGCTGCAGAGCTGTGCTGAAAACCGATGTGGCTGTATGCG
ACTTCTGCAAAAAGAGAGAATCTGAGCTCTATCAAAAGGA
GATTGCTCATCTGTCGACACTAGAGGAGAAATTCTCTCGC
CTGTGGACTCAGTGTCAGCGCTGTCAGGGTTCACTTCATG
AAGACGTGCTTTGCACCAGTCGAGATTGCCCCATCTTCTA
CATGAGGAAGAAGGTGCAGAAAGATTTAGACGATCAGGAG
AAGCTCGTCTCCCGTTTCGGCTGGTGATCAATGACCATTT
TTTTCCTTCTCAACATTCATTTCTCGACGTCTTCTTACCT
CAAAGATGGAGTCTGTCAAACTCCAGATTGTAAAGAATCT
TCATTTTGTAGTGGCTGAATAAATAAGTGCATTTTTGTAA
A

pold1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pold1-201 3561
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pold1-201 Contained in:
OTHER pold1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045329 (1)
  • Ensembl_Trans:ENSDART00000055859 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY883095 (1) 3562bp
    GenBank:BC124083 (1) 3562bp
    GenBank:BC163875 (1) 3436bp
    GenBank:CK678100 (1) 560bp
    CITATIONS (2)