header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1389
Transcript Name: elof1-201
Previous Names: elof1-001, ch73-346m18.3-001, dkey-93n13.1-002, ottdart00000045180

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045180|OTTDARG00000032358|ZDB-GENE-040426-1385 elof1|OTTDARP00000035712 CH73-346M18.3-001 LG_ CU571395.6 Danio rerio protein_coding NOVEL, 1232 bp
GTGAATCCTCTGTTTATTCTCTGCAGGCTGTGCGTGCTTT
TCTCCAAGAGCTGCTTCGTAATATTTGCAGTTTCTACTAA
ACAGCATGGGACGCAGAAAGTCCAAGAGAAAACCTCCTCC
CAAGAAAAAGATGACTGGAAACCTGGACACCCAGTTCACC
TGCCCCTTCTGTAACCACGAGAAATCATGTGACGTTAAAA
TGGAACGGAGTCGAAATACCGGGATAATATCATGTACTGT
GTGTCTAGAAGAATTCCAGACACCAATAACCTATCTCTCG
GAGCCGGTGGACGTGTACAGCGATTGGATAGATGCTTGTG
AAGCAGCCAATCAGTAGTTTTGCTGGGTCAAAATGTCATA
AATGACCAAATACACTTAAGATTTTTGTTTGTGTTTGTTA
TTTTTAACTCCCATGAATCGCTGTCCCATCTTCTATGGAA
AGTTAAAGGGGTAGTTCACCCACAAATGAAAATTAACTTA
CTGTTTACTGCCAGACAAGTGATTCTAAACCTTTCTTATT
TTTGTTGAAGCGAAAAGGAGATATTTAGAAAAATGTTGGA
AACCTGTAACCATTGACTCCATACACTCAGAAATAAAGGT
ACACGAGCTGTCACTGGGGTGGTAGCTTTTCAAAATGTAC
AAATTTGTACCTAAAAGATTTACATTAATACCTCAAAGGT
ACATATTAGTACCTAAACAGTACAAAAGTGTTCCTCTTAA
AATCTGTAGGTAATAATATATGCTTTTGAGGTACCAATAC
GGACCCTTTAAGTACAAATGTGTACCCTTTGAAAAGGTGT
CACCCCAGTGACAGATCACGCACCTTTTATTTCTGAGTGT
GTAGTAGGGAAAACAAATACTATTCAAGTCAATGGTTACA
CGTTTCCAACATTCTTTAAAATATCTTCTTTTGTGTCTAA
CAGATAAAGAAACTCATACATGTTTGAAACAAGTAAAAGG
GTGAGTTTTGGGTGAACCGTCCCTTTAGGAGATGATCTAA
TAATGCTACAGATGGAGATTCACACAACATTAAGTAGATT
TATGAAGTCTTTTCCCTTTAGTTTAGTGTTACAGAAATGC
TTAGAAAATGTAAAGGATGTTGTTATTTTTTTCCAAGATG
GATAATTTCCTGTTTGTTATCTTTTAGTTTGTCTTGTTTA
TTTTACAATTTGAGGTTTTTATGAGACCATTTAATGCCAA
TAAACAATTTGTGCATTTTCTCTTGTGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
elof1-201 Contained in:
OTHER elof1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045180 (1)
  • Ensembl_Trans:ENSDART00000172102 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053290 (1) 1255bp
    GenBank:EH548870 (1) 963bp
    CITATIONS (2)