Transcript

cnksr2a-202

ID
ZDB-TSCRIPT-091110-1265
Name
cnksr2a-202
Previous Names
  • cnksr2-001
  • cnksr2a-001
  • ch211-56a11.1-001
  • dkeyp-121e10.1-001
  • ottdart00000044589
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044589 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044589|OTTDARG00000031980|ZDB-GENE-060228-5 cnksr2a|OTTDARP00000035234 DKEYP-121E10.1-001 LG_none BX571698.16,CU929293.7 Danio rerio protein_coding NOVEL, 2050 bp
CAGCCGCGTTGAAGGGGCATCCGCAGAAAGTTTCACGATG
GCTCTCGTCATGGAACCTGTTAGTAAATGGAGCCCCAGTC
AAGTTGTGGACTGGATGAAAGGTCTGGACGACTGTTTGCA
GCAGTACATAAAGAACTTTGAGCGGGAGAAGGTTGGAGGA
GACCAGCTGTTGAGGATCACCCATCAGGAACTGGAGGATC
TGGGAGTTTCTCGCATCGGCCATCAGGAGCTCATCCTGGA
GGCTGTGGATCTGCTGTGTGCTCTGAACTACGGGCTGGAG
ACCGAAAACCTGAAGACTCTTTCGCACAAGCTCAATGCCT
CTGCCAAAAACCTGCAGAACTTCATCACAGGCCGCAGACG
CAGCGGCCATTATGATGGCCGCACCACTCGGAAACTGCCC
AATGACTTCCTCACGTCTGTGGTGGATCTGATCGCCGCTG
CTAAGAGCCTTCTAGCCTGGCTGGATAGGTCACCATTTGC
TGCTGTAACAGATTATTCCGTGACCCGGAACAACGTGATC
CAGCTGTGCCTGGAACTCACTACCATTGTTCAGCAGGACT
GCACCGTCTATGAAACCGAAAATAAGATCCTCCATGTGTG
TAAAACTCTGTCTGGAGTTTGTGACCACATCATCTCACTG
TCTTCAGACCCTCTGGTCTCTCAGTCGGCTCATCTGGAGG
TGGTCCAGCTGGCTAATATCAAACCTACAGAGGGTCTGGG
AATGTACATCAAATCCACATATGATGGCCTTCATGTTATC
ACAGGAACCACAGAGGGGTCTCCAGCAGACCGCTGTAAAA
AGATCCACGCAGGTGATGAGGTTATTCAGGTCAATCATCA
GACTGTGGTGGGCTGGCAGTTGAAAAACTTGGTAAGCTCT
CTGCGTGGGGACCCTGCCGGTGTGACATTGACCCTGAAAA
AGCGTCCCCAGAGCACCCTCACCTCCGCCCCAGCCCTACT
AAAGAACATGAGATGGAAGCCCTTGGCCCTGCAGCCAGTC
GTTCCTAGGAGTCCCACCAGCAGCTCTGCCACTCCCACAA
GCACCATCAGCACACCCTCGAAGCGTGATAGCTCCGCCCT
GCAGGACCTGTATATTCCGCCTCCTCCATCTGAGCCATAC
ACACCCAGAGATGAAAAAGGCGGTATCCAAAGTGAGAGTG
GGGTACCTGTCGCAAAAGGATCAGAATCACCAAACTCATT
CCTGGATCAAGAATACAGGCGGCGATTTCCTCTAGTGGAA
GAGGAGGCTGTCCTGTACTGCTACGAGTACGACCCCAGCC
ATGGACCCACAACATCCCGTCGGGACAGCACCCCCACTTA
TGGTCGTCTGAGGCCCATCTCAATGCCTGTGGAGTATAAC
TGGGTTCCTGACTATGAAGACCCAGCTAGAGTGAAGAGAG
ACGGTCGGAGAGAAAACTCTTTGTTGCGGTATGTAAGTGA
TGAAAAGGCTGCTGATCTGGCAGGACGGAGCATGAAGAGA
GACACTGGAAAGCGTGGAAAGAAGAAGAGCGAGAAAAGCG
GGAGCCCCACACACTACTCCCTCCTTCCCACCCTGCAAAT
GGAGGTGCTACGTCAGGAGTCCATGAACACGCCAAACCCA
GACTCCACCTCTCTCTACCATGTGAGTAGCATGTTTTCTG
TCAAAGATTCGTTGGGGGACTTGTACAGAGCGCTGGAGCG
TGCCCGTCTGACACCTATTGGTGAGCACCGCCTTTCCACT
CGTCTGGAGTACAAACATCTTTTCATCCGGCGTTGCAACG
ATCCACAGCTAAATGACAAACTGCATCACCTTCGCATCCT
GCAGAGCACGCTAAAGGTATCCGAAAGGGAGGGCGAAGTA
GCACTGATTGACAAGCTGCTGGCCAATCCTAAGCTCACGT
CCTCAGAGTTCCAGGAATGGAAGAAAGTTTACATGGAGGC
GTTTTCAGAAGAGCCACAGCGGGACCGTCAGCCCAGCCCT
GCCTCTGAGCCCAGCCCTGCCGCTACGCCTGAGCCTGCCC
CCCGCACGCCCTCCCTCTCGCACACACACTCCTACATCGA
GACTCACGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations