header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1108
Transcript Name: pde6b-201
Previous Names: dkey-30k6.3-001, pde6b-001, ch211-263m18.2-002, ottdart00000043939

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043939 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043939|OTTDARG00000031559|ZDB-GENE-090421-2 pde6b|OTTDARP00000034824 DKEY-30K6.3-001 LG_ AL844141.7 Danio rerio protein_coding NOVEL, 5593 bp
AAAGAGCTTGCAGCGCAAAGGAACAAGCCAAATGATTGTG
CACTACCACTCACATACAGTTATGCTCATATAGATTTACC
TCCAAAACTGACACAAGAGCATCTCTTCTCTTCCCCAGGA
CTCTTAAAAAGTGGTTTAAGAAGGACTTCACTTGGTTTCT
TCACTGGGCTCCGGCTTTGATGCTGCAGGTCACCTGATCA
GTTTTACTAGAGCAGATCCTGATTCACCTTCAACACTATT
AGGAAAACACCTTGCTGATGACAGTTCGATTGGATACGGG
TCGCCCCTGCTGCTGCAGGCACCTTTTTTTCTTCACTATC
TGAGGATTACATGCTGTAAATTTCAACTTTTTTTTACTTC
TAAAAGCTAATCTGAACTCTCAATACCTCCAGTACCTGAA
CTGGGCTGGAAGATCCCAAGATGAGCGTCAAAAAAGAAGA
TGTGGAGAAGTTCCTGGATGGAAATCCAGATTTCACCAAA
ACCTACTTTGACAAGAAGCTCAAACCTGGTGCTGTGGCCT
CAATCATGCGAGTGCCCGAGTCTAAAGTGGACATGGACAG
TTTTAAGGAGATCGTCTCGGTGGAAGAGGGAGCAATTTTC
TACGATCTCATCACAGACATGCAGGAGAACGTCAACATGG
AGAAGGTGATTTTTAAGATTTTGAAGAGAATCAGCGCTCT
GATTCATGCGGACCGCTGCAGTCTCTTCATGTATCGGCAG
AGGAACGGCATTGCCGAATTGGCCACACGTCTCTTCAACG
TTAATAAAGACTCAGAGCTGGATGATTGCGTGGTAGCTCC
AGACTCTGAGATCGTCTTCCCTCTGGACATCGGGATAGTT
GGACATGTGGCTCAGACCAAGAAACAAGTCAATGTGAAGG
ACGTTACACAGGACAGTCACTTCAGCACATTCGTTGATGA
GCTTACTGAATACACCACACACAACCTCCTGGCTGCGCCT
ATTATGAATGGAAAAGATGTAGTAGCTGTGATCATGGCTG
TCAACAAGACCACCGGACCCCATTTCACAGATGAGGATAT
GGATCTTTTTTTAAAGTATCTCAAAGTTGGCTCTCTGAAC
CTGAAGATTTTTCATCTGAGCTACCTTCACAACTGTGAGA
CGCGTAAAGGACAGCTGCTGTTGTGGTCGGCTAACAAGGT
GTTTGAAGAGCTCACAGATATTGAACGACAGTTTCACAAA
GCTTTGTACACAGTGCGAGCTTACCTCAACTGTGACAGGT
ACTCTGTGGGCCTGCTGGACATGACCAAGGAAAAGGAGTT
CTTTGATATTTGGCCCGTGCTGATGGGGGAGCAGCCACCT
TACTCTGGCCCTGTAACTCCAGACGGAAGAGAAATAATTT
TTTACAAAGTTATCGATTATATTTTGCATGGGAAAGAGGA
CATCAAGGTCATACCAAATCCAACTGCAGATCATTGGGCT
TTGGCTAGTGGATTACCCACATATGTAGCAGAGAGTGGAT
TTATTTGCAACATCATGAATGCAGCATCAGAAGAAATGTT
CAAGTTTCAGACAGAGGCTCTGGATGATAGTGGATGGACC
ATCAAGAATGTGCTCTCCTTGCCAATTGTCAACAAAAAAG
AAGAAATTGTTGGCGTTGCAACTTTCTACAACAGGAAGGA
TGGCAAACCATTTGATGAACATGATGAGCAACTTATGGAG
GCTTTGACACAGTTTTTAGGCTGGTCGGCTCTCAACACAG
ACACCTACGACAAAATGAATAAACTGGAGAACAGGAAAGA
TATTGCCCAGGACATGGTGCTGTACCATGTCAAATGTCGA
GATGATGAGATCCAAGATATCCTCAAAACAAGAGAATATT
TTGACAGGGAGCCAAGGGACTGCGAGGAGGAGGAGCTTTT
GGAGATTCTGAAAAAAGAGCTGCCCGGCCCCAAGAAGTTT
GAGATCTACGCTTTCCATTTTTCAGATTTTGACTGCACTG
AACTCCAGCTTGTTATGTGTGGCATCCAGATGTACTATGA
AGTTGGAGTGGTTAAAAAGTTCCAGGTCCCTCAGGAGGTT
TTGGTGAGATTCATGTACTCTGTCAGCAAAGGTTACAGGA
GAATCACGTATCACAACTGGCGCCATGGCTTCAATGTTGG
ACAAACCATGTTCACTTTACTCACGACAGGCAAACTGAAG
CAGTATTACACGGATTTGGAGGTGATGGCCATGATCACTG
CCGGTTTCTTGCACGATATCGACCACAGAGGCACAAATAA
CCTCTACCAAGTGAAATCCCAAAATCCTCTAGCCAAGCTG
CATGGATCCTCCATTCTAGAAAGGCATCACTTGGAATTTG
GCAAATTCCTGTTAGGCGAAGAGTCGTTGAACATTTTCCA
GAACCTCAACAGAAGACAAACAGAACATGTCTTCCACCTC
ATTGATATTGCCATTATTGCAACTGACCTTGCCTTGTACT
TCAAAAAGAGGACGATGTTTCAGAAGATTGTGGATCTCTC
TGAAACCTATGAAGAAAGAAAGAAATGGATAGACTTCATG
TCACTGGAGACAACAAGGAAAGAAATTGTAATGGCCATGA
TGATGACAGCGTGTGATCTCTCAGCTATCACAAAGCCATG
GGAGGTGCAGAGCAAGGTTGCCCTCTCTGTAGCAGCTGAA
TTCTGGGAGCAGGGTGACCTTGAGAGGACCGTTCTTGAGC
AACAGCCTATTCCCATGATGGACAGAAACAAAGCTGCAGA
GCTGCCGAAGCTTCAGTGTGGTTTTATTGACTTCGTCTGT
ACTTTCGTCTATAAGGAGTTCTCCCGTTTCCATCCTGAAA
TCAAGCCAATGTTTGATGGTATTCTAAACAATCGGATGCA
TTGGAAAGAGAGGCAGGAGGAATATGAGGCAAAACTAAAG
GCAATGGAAGAGGCAGTCAAAGCCAGACAGGAAGCAGCTG
CCAAAAACGCTGCAAATTCCAACAGCACCGGCGGATCAGG
GTCCAAGACCTGCTCTATCTGTTAGAGAAAAGACAACAGT
ACAGAGAGCAAGGCATCTCAAGATGCAGCCTGGCCTCCTA
AGTATTAAGTCAAACAGGGGGAGATCATCCTTATCCCTAG
GATTTGCAAGGATCTGATCAAAGAGTGAGTGTAAAAAAAC
ATATCAATGCTCTCAGCAAGTCACAAGACCACCTACTTAC
TAAAACATTGTTGGATCTTGCCTTGCAGTTAGTATTACTC
TTCAATTGTCTTTCCTTTTGGTCATAGTGTTTGTTTTAAG
CAGTTTCATTGAGCGATAGACGGTTTCAATAATGACGATG
CATTTTAAATGTACTACAGAAGTGAATGTTTTTCATTTAG
TCCCTTACTGGACATTGCCTGATACTTGATATCAACCAGG
TCCACAACAAGTTGATGTACAATCATGTGCAGAATGTTAT
TGTAATTTAAGGAACTTGTGGTAATAAGAAACGGGAATAA
TTGTGCATTTAGCGTCACCCTTAACTTACATATTTATTCC
CTCTAAAAGTGATCACATCATACTGCTGGGATGCTAATGA
GCTTTTGTAGGCGCATTAATGTGCAACTGGATATATACTA
ATGAGCCAAAACAATATGACTGAGTAGATTAGATGTAACC
AAACAATCACAATCTTGTAAATCATTGTGTTGGATACAGT
AGAGATGGGTAGGAAAAAAAGACCTGAGTAAATTTGACGA
GGCTCAAAAAGTGATTGGTATCTGGGTCTCTGAAACGGCA
AGATTTGTAGGTTGCTTTTAGTCAGCGTTAAGTGAAAATT
TACTAAAAAATGTCAGAGGAAAGACAACACTAAAATTAGC
AACAGGATGTTGGGCAGCTAAGCTCATCAATGACAACAAA
CAATATCCTGTATGGTCCAAGCCAACAAAAGGTCTACTGT
GCCACAAGTTGGAGTAGCATGGTGGCACAGTGGGTAGTTC
TGTCGCCTCAGCAAGAAGGTCACTAATTCGATTCACGGCT
GGGCCAGTTGGCATTTCTGTGTGGAGTTTTTGCATGTTCT
CCCCATGTTCACATGGGTTTCCTCCGGGAGCTCCGGTTTC
CCCCACAGTCCAAACACATGCGCTACAGCTGAATTGGGTA
AGCTAAATTGTCCGTAGTGGTTGAGTGTATGTCCTAGTCC
TCCAGGTTGGGGTTGAGCTTTGGGCTAATGACCCACCTTA
TAAAATATTAGATGTTACGAAACACCAACATGGTGCAGCT
AAATATAAACTTTGATTTAAACGGCCCTGGGAGTGAGTAA
GGAAGTGACACAAGTTACACAAAATGTAATAGTTGTTAAA
GCAGGAGTGTGTCACAACACAAAATGTAATTCAGCTGCTC
TGTCCACTCATGAAAGCACCTAACATAAATATATGAGTGT
CGGAACTGGAATTGGAGAAGTTTTGGAGAAGCTTGCTTGA
CCAATTAAGCTCTCTGCACTTTAAGGTTGGCTATCTAGAT
GTACACTATTTACTTGGGGGAGTGATAGGATGTAAATTTG
ATATGCTACCTAAATAAATATTGTTGCAGACTGGGTATAT
CTATTGATGTCAATGGCATCCTTTTTGAAAGTGGCCTCTT
TCAGCAGGTTAATATACCCTGTCACATTTTACACATTGTC
CATGAATGGTTTGAAGAACATAAAGAGATCAATGTGTTGC
TTTGGCCTCCAAATTCCCGAAATCTCAAACCAACTGAGCA
TCTGTGGGATGTGCTGGACCTACAAGTGCAAGCCACAATG
CTTCCACATTAAAACCTACAAGAACTGAAGGACCTCTGTG
GGTCTTGTAGCCATGCCTCAGCATGATGGTGCTTACTAGG
CAGGTGGTCATACTGTTTTGGCTCATCTGTGTAGATGTAT
AAAACTAGCTCTAAAGTATTTTTTCATGTCTTCACTTAAG
CTGACAGGTAATGTGCGCTATTGTCCTTCAGACTTATTTA
CTACATCAAGTGCTGTCATGGGTGTGTTTTACTGAGCGGT
GTCCCATTTCTCAGTGTCTCTGCTGTTGGGACATGCGTTC
ACAGAGAAAACTAATTCCAGTGGCCTTGATACTATTCATC
TGTCCAGTTCTCAGCCGACCTGTCATCGCAGTCTCTGTTT
AAATCCATTATGTTTTTCAGATTTGGGCTTTTGTTTTGTC
TTATGTCGGACTTTTATAGGATTCAACTGATTGTCTGTAA
AGCATCTTAAAAAGATCTAATTATGTAAATATACTTAAAT
GATACATTTTACTAGTTTAAAGTGAAACACTATTAAGGTG
TTTTCTAGTGCACATAATGAATTCTACATGCTTATTATAT
AAAGCTGCTGCTTGTGTTTCACAAATTAAAGTAGTGAAGG
ATCAGACTGTAGCAAGAAAATGTTGAAATCATCATGTCAG
ATCTGACAGCAAGGGCCTAGAAATAAAACTTGTTTTGACA
AAAATGTGATTTACTTGCAGAGCAAGTTTAATCATTTGGC
AAGAATTTGATTATTTATTTGATCATCAAATATGACTACG
TCAAACCATCAAAAATACCTCAAATTGGGTGATTCCAATT
TAATTGGTAAAAAATGTAAAGCTTCACTTTGTATGCTCAA
TACCATGACAATTAAAGCATTTATTTTGTATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pde6b-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043939 (1),  Ensembl_Trans:ENSDART00000135816 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH457068 (1) 1036 bp
GenBank:CF999587 (1) 798 bp
GenBank:EB956789 (1) 780 bp
GenBank:DN857879 (1) 773 bp
GenBank:DN856408 (1) 712 bp
GenBank:EB959066 (1) 691 bp
GenBank:EE202989 (1) 671 bp
GenBank:EE202988 (1) 608 bp
GenBank:EB961632 (1) 577 bp
GenBank:EE200981 (1) 549 bp
GenBank:EB961454 (1) 527 bp
GenBank:DN903061 (1) 498 bp
CITATIONS (2)