header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1085
Transcript Name: slc22a21-201
Previous Names: slc22a21-001, smpd4-002, ch1073-409b12.4-001, si:ch1073-409b12.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043855 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043855|OTTDARG00000031504|ZDB-GENE-091118-62 slc22a21|OTTDARP00000034761 CH1073-409B12.4-001 LG_ CU469525.5 Danio rerio protein_coding NOVEL, 1045 bp
TGTGTGATGCTGGTCTTCCCGGTCTCCCTCCGCCCACCGC
GGGCTCTGGAGCTCCGCAGCCGCCGGAGTCGCTCTTCATT
CGGCTGCTATGAACCTCCAGGACTACGAGGAGCAAACCGC
GTTCCTGGGCGCTTGGGGCCCGTTCCAGAAGACCGTCTTT
AGCCTGCTGTGTCTGAGCATCATCCCGAACGGATTCACCG
GTTTATCCATCGTGTTCCTGGGTGACACCCCGGCCCATCA
CTGCCGGATCCCCGAGACGCTGAACCTGACGGCGGGCTGG
AGAAACGCGTCTGTGCCGCGACCACAGCCGCACGGAGACC
CGCGTGCCAGCAGGTGCTACAGACTCCGACTAGACCTGGT
GAAGAACTACTCGGACGGTGGTCTGTTGCCCGGACTGGAC
GTCAATGTGTCGGAGATCCCCCGGGAGGAGTGCGCGGACG
GCTGGATCTACGATAAAGAGATTTACAGCTCCACCATAGT
GTCGGAGTGGGACTTGGTGTGTTCGGATGACTGGAAATCT
CCACTGACCTCCTCAATCTTCTTCTGTGGTGTTCTGACTG
GTTCTGTGATCTCCGGTCCAGTGTCGGACAGGTTTGGCAG
GAAAATCGTGCTGTTCGTGACGATGGCGATTCAGACGCTG
TTCACCGTCGTTCAAGTCTTCTCTCCATCTTGGCAGATTT
TTTGTTTGCTGTTTTTCATTGTTGGAATGGGTCAAATTTC
TAACTATGTGGCAGCGTTTGTTTTAGGAATGGAGATTCTG
AGCTCGTCTGTTCGGGACGTGTACTCCACTCTGGGTGTGT
GTCTGTTCTTCTCCATCGGCTACATGATTCTCCCGCTGGC
CGCTTTCTTCCTGCGGGACTGGAGATCTCTGATGCTGGCC
CTCACCATCCCCGGGTTCTTCTACATCCCCCTGTGGTGGT
TTATTCCCGAGTCTCCGCGCTGGCTGCTGTCTCAGGGCCG
GGTCCAGGAGGCGGAAGCCATCATCAGAAAAGCAGCAAAG
ATAAACAGAGTTACAGCTCCGGACGTCATCTTCCCCTTGA
TGCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc22a21-201 Contained in:
[Fosmid] CH1073-409B12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043855 (1),  Ensembl_Trans:ENSDART00000135034 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN319141 (1) 890 bp
GenBank:EE699995 (1) 868 bp
GenBank:CA475848 (1) 841 bp
GenBank:CK236151 (1) 810 bp
GenBank:FP152636 (1) 564 bp
CITATIONS (2)