ZFIN ID: ZDB-TSCRIPT-091110-1065
Transcript Name: whrna-202
Previous Names: dfnb31-001, dfnb31a-001, ch73-272g3.1-001, dkey-11o15.8-001, si:ch73-272g3.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043764 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043764|OTTDARG00000031441|ZDB-GENE-091118-27 dfnb31a|OTTDARP00000034687 CH73-272G3.1-001 LG_none CU468727.9,CU571332.2,CR376852.17 Danio rerio protein_coding NOVEL, 3469 bp
TTTAAATGTGCATAGTTTATATCCACTCATCGTTTTACTA
TCATTTTCAATGTTTTAAAAAACTATTAAGATTATATTTG
ACATCGCAATGAACATTACTTTTTAATGATACAAATTTGA
CTTAACATTTGCCTGAAAAGTGGTTATTTTTTACTTTTGT
TTTCTGGCGTAATTTAATGCATGTTTCTTTCTTTAGGCAT
TACAGGTCCTCTGTGACCCGTTTGGCGTGAGATTAAGCAT
GACAGCGAGCATCGAGGCATCGCAGTGCCATGCGGCGCTC
CGCAGACTCCTGTAGACTCGGTCCCGGTGGTACTGCAATG
CTCGCCGGGCCCCTCCACTTCCGCGTACTGGCTCTGTGAT
CCAGGCAAAGGGCGCGAGGATGAGCACAGACCTGGAGCGC
CTGTCGCTGAACTCTTCCTCGGGGAACTCCGTGGCTTCCA
GCGCGCGTTCCCTTTCCGCCAACGTCAAAAAGCTTCACAA
CGCGCTCAACCTGCTGCTCAGCGACCTCGAGAGAGAGCAG
TTCATCCACTGTCTCAACGTGTACCACTCCAAGCGCAATG
TCTACGACCTGGTCCAGACGCTTAAAGTCATACTGAACGT
CCCGAGCAAGCGTCAGCTCCTGCCCATGCTGCGGCTGGTC
ATCCCGCGCTCGGATCAGCTTCTGTTTGATCAGTACACAT
CCGAGGGGCTATACTTGAAATCCGAAATCCATGCGCGCAA
CGGAGACCCGGACGGTGCCCAGGAGGGTGCTAACTCGAGT
CCAACACATGGGGCTAATTTCCCGGCGTCTCAAGTCGCTC
TACGCGGGTCTCCTGACAGCATCAGCACCAGCAGCGACGG
GACAGCGACTCTTATTCCTTTACTGGGGAGGAATTTCTTA
CCGGAGCCCCCTGGAGAGATCCGACAGGTGATCCTCAAGC
GTCACAAGAGCAATGAAGGTTTGGGATTTAGCATCCGCGG
AGGATCAGAGCATGGAGTTGGAATCTATGTTTCACTGGTG
GAACCTGGATCACTGGCTGAAAAGGAGGGTTTGAGAATGG
GAGACCAAATAATGAAAGTTAACGACAAAGTGTTTGACCG
GGTCACGCACGCGGATGCAGTAAAGGTGCTGAAAGGCAGC
AAAAAGCTCTGCATGTCGGTGCGTTCTGTGGGCAGGATAC
CAGGCGGTTATATCACCAATCACGTCTACACCTGGGTGGA
TCCTCAGGGGCGCAGTGTGTCTCCTCCACCCGACCTGCTG
GCGGAGCATCGCAGTGCCACCCTGCGCAGGTCCAACAGTC
AGGGCCGCAGTCACATGCAGCTACTGCAGGATGGAGATGA
GAAGAAGGTAAATCTGGTGCTGGACGACGGCCGCTCTCTG
GGTCTGATGATCCGCGGAGGAGCTGAATACTCTCTGGGTA
TCTACATTACAGGTGTGGACAGAGGCTCTGCAGCGGAGTG
TGGAGGGATTAAGGTGGGAGATCAGATCCTGGAGGTGAAC
GGACGGAGTTTCCTCAGCATCCCGCATGATGAAGCGGTCC
GAGTGCTGAAGTCTTCACACCACCTCATGATGACGGTGAA
GGACGTGGGACGGCTGCCGCACACCAGAACTGTAGTGGGA
GAAACTAAGTGGATCGCCAGTTCACAGATTTCTGACAGCT
CGGCCAGCAGCAGCGGGGGCTTTTATAAAGGTGTAGCGGG
ATCTCAGGTGACTCTGTCCAGTTTGGTGAACCAGAGCAGG
GCCATGCTGGAGGAACAGGCCAGACATCTTCTGACCGAAC
CGGAGAGGCAGACCATGGGTTACTACATCCAGGAATATCG
GGACGGGCACGTCGGTGTTGAGCAGCTCGTCATGGCTCTC
TTTGAGCTCTTCAATACACACGCCAAGTTTTCTCTGCTGT
CCGAGGTCAGGGGAATCGTGACCCCTCAGGATGTGGAGAA
ATTTGACGGTCTGGTCCTGAGACGAGAGATTGATGCCCTG
AAGGCGAGACAGGGTGGGGGAGCAGGTTTCCAAGACTCCT
TCTCCATGGTCTCGTATCCAGACACTTTGGCCTCCTCCTC
CGCCAGCTTCATGACCAACACTACCCTCAGCTCCGCAAGG
AACGACGGTGTGGCGGAGAATAACGGGGAACAGGGGTCTC
TGGAGCACAGCAATGCCCTGCCAGACATCTCTCTGGATGA
GGTTCATTCCACCTCAGATTCTCCTCCTTCCTTTAAACCT
CCTCCTCCCCCAGGGCTCCAGCGGCGTCCCAGTCGAAAAG
CCACGCTTAGCAAACGTCCCTCTTCCAGCTCTTCCCAATC
AGGCCTGTACTTCACCGCTCCTTCTCGTTCCCACACCAGA
GAGTCCAAACACCCTAAAGCACCCAAAGCTTTCATGTCTC
CTCCTGGCACCCTCAAAATAGACGTCCCGGCATCTCAGCT
CTCAGTCGTGAGTCAGCATCCAATCGGACCTTTCCCAAGA
GTTCAGTCTCCTAATAAAGCGAAGCCTGCTCAGTCCTCAT
CTCCAATTCCTCCACCTGCACCGAATGTACCCGCTCCGCC
CGGTCCGCCTCCTCCTCCGCCTCCACCTTTGCCTCCACCC
TCTTGCCCGGATAAACCCACCCCTTCCTCCCCAGCGTCCA
ATCAGCATTTTGTGATGGTGGAGGTGCACAGGCCCAACGC
AGAGCCCGATGTGAACGAGGTCCGGCCGCTGCCACAGGTT
CGAGGAGGAACGTTATCACAGCTCTCAGACAGTGGCCAGA
CACTCAGCGAGGACAGTGGTGTGGACATACCTGAATCAGG
ACGTCTCAGTAAGGATACTAGCCCACGTCCCGCTCGCACC
AGAGCCCCTCGGGATGGGCATGGAGGAGGAGAAACGTCTG
CCAAACCGCCAGGTCTGTTGGAGCCGATGTCCACTTTAGT
GAGAGTGGCCAAAAGCGCCAGTACACTGGGCATCGCGATA
GAAGGCGGGGCAAACACACGTCAGCCCCTCCCACGCATCG
TTACTATTCAGAGAGGCGGTTCAGCTCACAACTGTGGACA
GCTAAAGGTGGGTCAGGTAATCCTAGAGGTGAATGGAGTG
TCCCTCAGAGGAAAGGAGCATCGGGAAGCGGCACGTCTCA
TCGCCGAGGCCTTTAAAACCAAAGAGAAGGACTACATTGA
CTTCTTGATCACAGAGTTCAATGTGGCTCTGTAGGACCCC
GTGATTAAAGAGCATTGGGATGGATCCGCAACACGTCTTG
CCATGATTAACCTCCCAGAATCTTGATCCATGGCGCACTT
CGTCTCATCCTCCTCTGTGATGTTTTGAAACCAGTCGCTG
TTTGAAAGGCCATCCCGTGTGGATCAACCCCATCTTGACC
TTTTAGATGGCAAATGCCAGGATAGAGCAGTTGAGTCTGT
TCTGGAAGATTGGGCCATCTTTTCAGTTGGCTTATTCTAT
GTGAGATCCTATAATGAAATTTGGTCACCTGACCCCAAGA
GACTCTTTATCAAGCTCGGATCTGTGTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
whrna-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043764 (1),  Ensembl_Trans:ENSDART00000145366 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD760225 (1) 870 nt
GenBank:CT654854 (1) 843 nt
CITATIONS (2)