Transcript

tmem11-202

ID
ZDB-TSCRIPT-090929-9981
Name
tmem11-202
Previous Names
  • tmem11-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027423 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027423|OTTDARG00000021530|ZDB-GENE-050417-37 tmem11|OTTDARP00000022464 DKEY-91D10.2-002 LG_ BX914211.5 Danio rerio protein_coding KNOWN, 1006 bp
GGGAGACAGAGAGCAGCGCTGCACGTGTGCGCCGTGCAGT
TGTTATAACACGGTTTTCCCCTTTGCAGCAGCTCCGTGGG
CGCCGTACGGGGAAGGGACTCACTACACAAAGCAGAACCG
ACCACATTATGGGGGAGTGATGGCGGCCACGGAGTGTTAC
ATCGTCCACGAGATCTACAACGGCGAGAATGCACAGGAGC
AGTTCGAGTACGAGCTGGAGCAGGCTCTGGAGGCGCAATA
CCGCTACATCGTGATCGAGCCCACGCGGATCGGAGACGAG
ACGGCCCGCTGGGTAGCCGTGGGGAACTGCCTGCACAAAA
CCGCTGTCCTGGCCGGCGCCGCGTGCCTCCTGACGCCGCT
CGCCCTCCCCGTCGAATACTCCCGTTACGTGGCGCTGCCG
GCTGGCGCTCTGAGCTTGGCCTGTGCCACGCTGTACGGCA
TATCCTGGCAGTTCGACCCCTGCTGCAAGTACCAGGTGGA
GTACGACAGTCAGAAGCTCTCGCGGCTGCCCCTGCACACA
CTCACCTCCTCCACGCCGGTGGTTCTTGTCCGACGGGACG
ACGTGCACAGAAAGAGACTGCACAACACGATAGCGTTGGC
GGCCCTCGCGTACTGTGCCAAGAAGATCTATGAACTGTAC
GCTGTATGATCCACACACACACACACACACACTGAGGCAT
ACAGATACTGATGTACACACACAAACAAACACGCGACAGG
GAGGTGAGAAGCACTACTAAACACCCTACACACACAATAA
ACACATGGACCGACAGAGAGCGTGATCAAAAACAAACAGC
AATGCATCTCTCTCTCTGTCAAGATTTTTCATCGTTTTGC
TTTCGACCGGTTTATGATTGGACAGATTGACGAGCGGACG
GACGGATGGATAGATGAGAGGAAAGGTTTTGGGCAGGGGG
GCGAGCTTATAGTTCTGAATGAATCTTTCCCTTTTCTTTG
TACTTTAAAAGTGAAATCACCGGTGCACTTGAGCCCCCAG
TTCCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations