ZFIN ID: ZDB-TSCRIPT-090929-9981
Transcript Name: tmem11-202
Previous Name: tmem11-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027423 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027423|OTTDARG00000021530|ZDB-GENE-050417-37 tmem11|OTTDARP00000022464 DKEY-91D10.2-002 LG_ BX914211.5 Danio rerio protein_coding KNOWN, 1006 bp
GGGAGACAGAGAGCAGCGCTGCACGTGTGCGCCGTGCAGT
TGTTATAACACGGTTTTCCCCTTTGCAGCAGCTCCGTGGG
CGCCGTACGGGGAAGGGACTCACTACACAAAGCAGAACCG
ACCACATTATGGGGGAGTGATGGCGGCCACGGAGTGTTAC
ATCGTCCACGAGATCTACAACGGCGAGAATGCACAGGAGC
AGTTCGAGTACGAGCTGGAGCAGGCTCTGGAGGCGCAATA
CCGCTACATCGTGATCGAGCCCACGCGGATCGGAGACGAG
ACGGCCCGCTGGGTAGCCGTGGGGAACTGCCTGCACAAAA
CCGCTGTCCTGGCCGGCGCCGCGTGCCTCCTGACGCCGCT
CGCCCTCCCCGTCGAATACTCCCGTTACGTGGCGCTGCCG
GCTGGCGCTCTGAGCTTGGCCTGTGCCACGCTGTACGGCA
TATCCTGGCAGTTCGACCCCTGCTGCAAGTACCAGGTGGA
GTACGACAGTCAGAAGCTCTCGCGGCTGCCCCTGCACACA
CTCACCTCCTCCACGCCGGTGGTTCTTGTCCGACGGGACG
ACGTGCACAGAAAGAGACTGCACAACACGATAGCGTTGGC
GGCCCTCGCGTACTGTGCCAAGAAGATCTATGAACTGTAC
GCTGTATGATCCACACACACACACACACACACTGAGGCAT
ACAGATACTGATGTACACACACAAACAAACACGCGACAGG
GAGGTGAGAAGCACTACTAAACACCCTACACACACAATAA
ACACATGGACCGACAGAGAGCGTGATCAAAAACAAACAGC
AATGCATCTCTCTCTCTGTCAAGATTTTTCATCGTTTTGC
TTTCGACCGGTTTATGATTGGACAGATTGACGAGCGGACG
GACGGATGGATAGATGAGAGGAAAGGTTTTGGGCAGGGGG
GCGAGCTTATAGTTCTGAATGAATCTTTCCCTTTTCTTTG
TACTTTAAAAGTGAAATCACCGGTGCACTTGAGCCCCCAG
TTCCTA

tmem11 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmem11-201 (1)    Ensembl 1195
tmem11-202 1006
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem11-202 Contained in:
[BAC] DKEY-91D10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027423 (1),  Ensembl_Trans:ENSDART00000135299 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE711964 (1) 957 nt
GenBank:CA477121 (1) 929 nt
GenBank:CA477497 (1) 905 nt
GenBank:CA475347 (1) 878 nt
GenBank:CK139254 (1) 861 nt
GenBank:CN324459 (1) 850 nt
GenBank:CK140639 (1) 830 nt
GenBank:CD753730 (1) 823 nt
GenBank:DV588108 (1) 810 nt
GenBank:DT872409 (1) 758 nt
GenBank:CT688950 (1) 751 nt
GenBank:DY568905 (1) 721 nt
GenBank:AL907244 (1) 569 nt
GenBank:CD281337 (1) 545 nt
GenBank:CD280996 (1) 236 nt
CITATIONS (2)