ZFIN ID: ZDB-TSCRIPT-090929-9980
Transcript Name: tmem11-201
Previous Name: tmem11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027422 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027422|OTTDARG00000021530|ZDB-GENE-050417-37 tmem11|OTTDARP00000022463 DKEY-91D10.2-001 LG_ BX914211.5 Danio rerio protein_coding KNOWN, 1195 bp
CGACGAATTTTGCGTCAAGTCTAGTCCGTTGCTTTGTCAA
GATGGCGTCGCTGGGAAGGAGGCGCGGTGTCCCAGTCAAC
AGGGAGAGGGGAGTGATGGCGGCCACGGAGTGTTACATCG
TCCACGAGATCTACAACGGCGAGAATGCACAGGAGCAGTT
CGAGTACGAGCTGGAGCAGGCTCTGGAGGCGCAATACCGC
TACATCGTGATCGAGCCCACGCGGATCGGAGACGAGACGG
CCCGCTGGGTAGCCGTGGGGAACTGCCTGCACAAAACCGC
TGTCCTGGCCGGCGCCGCGTGCCTCCTGACGCCGCTCGCC
CTCCCCGTCGAATACTCCCGTTACGTGGCGCTGCCGGCTG
GCGCTCTGAGCTTGGCCTGTGCCACGCTGTACGGCATATC
CTGGCAGTTCGACCCCTGCTGCAAGTACCAGGTGGAGTAC
GACAGTCAGAAGCTCTCGCGGCTGCCCCTGCACACACTCA
CCTCCTCCACGCCGGTGGTTCTTGTCCGACGGGACGACGT
GCACAGAAAGAGACTGCACAACACGATAGCGTTGGCGGCC
CTCGCGTACTGTGCCAAGAAGATCTATGAACTGTACGCTG
TATGATCCACACACACACACACACACACTGAGGCATACAG
ATACTGATGTACACACACAAACAAACACGCGACAGGGAGG
TGAGAAGCACTACTAAACACCCTACACACACAATAAACAC
ATGGACCGACAGAGAGCGTGATCAAAAACAAACAGCAATG
CATCTCTCTCTCTGTCAAGATTTTTCATCGTTTTGCTTTC
GACCGGTTTATGATTGGACAGATTGACGAGCGGACGGACG
GATGGATAGATGAGAGGAAAGGTTTTGGGCAGGGGGGCGA
GCTTATAGTTCTGAATGAATCTTTCCCTTTTCTTTGTACT
TTAAAAGTGAAATCACCGGTGCACTTGAGCCCCCAGTTCC
TACTCCTTTCCCCTCCCTCGCCTGTCCCGCCCCTTCCTCG
TCCCACAGGCCCCCCAACCGTCACCTGCCACCCACACGGA
GCTCCCGCGACCGACCTGACGGACAGAGCGTGCGGTGGAC
AGACAGACAGACCTGTTTTAAGAATGAATCCTCTCTTTTC
TCCCTCTGTGTAGTTTTACTGTACCCTGCCTTTGGTGCGT
CACATTTTCATTAAACAGTAGGAGATTTAACCTCA

tmem11 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmem11-201 1195
tmem11-202 (1)    Ensembl 1006
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem11-201 Contained in:
[BAC] DKEY-91D10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027422 (1),  Ensembl_Trans:ENSDART00000104397 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC092726 (1) 1191 nt
GenBank:BC067587 (1) 1181 nt
GenBank:CT606403 (1) 721 nt
GenBank:CT656838 (1) 639 nt
GenBank:CT688951 (1) 605 nt
GenBank:AI964185 (1) 498 nt
GenBank:AL908304 (1) 462 nt
GenBank:BI983783 (1) 438 nt
CITATIONS (2)