header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9935
Transcript Name: ralab-002
Previous Name: zgc:92116-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027374 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027374|OTTDARG00000021497|ZDB-GENE-041114-195 ralab|no_translation CH211-202I17.1-002 LG_ CR786574.10 Danio rerio protein_coding KNOWN, 726 bp
GTGCTTTCTTGTTCTAGGGCTCACCTAATACCCATCTACC
TCTGACCTTACTTCAATACACTGCCATTGTCTCGCTGCTT
GAAGCCATGGCTGCCAACAGGAACGCTTTGGCTCTTCACA
AAGTGATAATGGTGGGAAGTGGCGGTGTGGGCAAGTCCGC
CTTAACTCTGCAGTTTATGTATGACGAGTTTGTGGAGGAC
TACGAGCCCACTAAAGCTGACAGCTACAGAAAAAAGGTGG
TTCTGGATGGAGAGGAGGTGCAAATTGACATCCTGGACAC
GGCGGGACAGGAGGACTATGCTGCAATTCGGGACAACTAC
TTCCGCAGCGGGGAGGGATTTCTCTGCGTGTTCTCCATCA
CAGAATCTGAATCCTTCGCTGCTACAGCAGATTTCAGGTT
GAGATGACACTGAAATATTGATCAATTCTTGTGTTATTGA
ATGTTCATGCTGTAAATGCATTCTTATTTATTACTACATT
TTAGAGAACAGATACTTCGGGTTAAAGAAGAGGAGAATGT
ACCTTTCCTTCTGGTGGGAAATAAATCAGACTTGGAGGAC
CGAAGACAAGTTGGTTTGGAGGAGGCCAAGGCCAGAGCGG
AGCAGTGGGGAGTCAGCTACGTAGAGACTTCTGCCAAAAC
CCGTGCCAACGTAGATAAGGTGTTTTTTGATCTCATGCGT
GAGATCAGAGCCAGAAAAATGGAAGACGGCAAAGAGAAAA
ATGGAA

ralab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ralab-201 (1)    Ensembl 2835
ncRNA ralab-002 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ralab-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027374 (1),  Ensembl_Trans:ENSDART00000145040 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BE016324 (1) 621 bp
GenBank:BE016967 (1) 615 bp
CITATIONS (2)