ZFIN ID: ZDB-TSCRIPT-090929-9934
Transcript Name: ralab-201
Previous Names: ralab-001, zgc:92116-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027373 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027373|OTTDARG00000021497|ZDB-GENE-041114-195 ralab|OTTDARP00000022422 CH211-202I17.1-001 LG_ CR786574.10 Danio rerio protein_coding KNOWN, 2835 bp
CTGGTAAAGATGACTAAAAGCAGATGCTAGATTGTGTCTA
CAGTAAACCCCGTCCAGTAACGTTATATGTATGGAGTCAT
TGTAATAATTTAAAAAGTTGCAAGACAACACTAAAACGGT
TTTGTATCTTAGAAAGTAACGCAAGTCTGAGACGTAACCC
ATCGAGTTTCGTGGCGTTGACTAGTTTAGATATTCGCATA
CATTAACAACATTTCTTTCCGTTCAGAAGTAAATTCTTAG
TCCGAGTGAGGAAGACCAAGCCCAGTCAGCCGAGGCTGTC
AGCAGTGCTGCTCCCTTCTCTGAGTCATCATGCACTGAGC
AAAACAAATCTGCCGTAGCAGCAAAGCTAACAACACCTTC
AACACACCAGTGCCTGTTTATTTGGGCTCACCTAATACCC
ATCTACCTCTGACCTTACTTCAATACACTGCCATTGTCTC
GCTGCTTGAAGCCATGGCTGCCAACAGGAACGCTTTGGCT
CTTCACAAAGTGATAATGGTGGGAAGTGGCGGTGTGGGCA
AGTCCGCCTTAACTCTGCAGTTTATGTATGACGAGTTTGT
GGAGGACTACGAGCCCACTAAAGCTGACAGCTACAGAAAA
AAGGTGGTTCTGGATGGAGAGGAGGTGCAAATTGACATCC
TGGACACGGCGGGACAGGAGGACTATGCTGCAATTCGGGA
CAACTACTTCCGCAGCGGGGAGGGATTTCTCTGCGTGTTC
TCCATCACAGAATCTGAATCCTTCGCTGCTACAGCAGATT
TCAGAGAACAGATACTTCGGGTTAAAGAAGAGGAGAATGT
ACCTTTCCTTCTGGTGGGAAATAAATCAGACTTGGAGGAC
CGAAGACAAGTTGGTTTGGAGGAGGCCAAGGCCAGAGCGG
AGCAGTGGGGAGTCAGCTACGTAGAGACTTCTGCCAAAAC
CCGTGCCAACGTAGATAAGGTGTTTTTTGATCTCATGCGT
GAGATCAGAGCCAGAAAAATGGAAGACGGCAAAGAGAAAA
ATGGAAAAAAGAAGAGGAAAAGTTTGGCAACGAGGATTCG
AGAAAGATGTTGCATTTTATAATGACTGGATCATGCAATA
TCGCTGACATCTCTACCCTTTCACTGCTTCCAAAAAACCC
ATCAGGTTTCATCCCTCTTCAGACAAATGCTGAAGATCAT
CTCCTACAAACACATCTCTCCATTTCCTCCGGTTGTTTTT
CTCAATGGGTATAAAAGGGCAAAACTTCAGATATGCATTA
AATAACAAATAATGTCAAAGGTCTGACATATCAGATACAA
CATTTCATTTCCCAACTCTCTGTAATAGACTGTTAGATTG
TGTTCACTCTTTAGTTGCTTTTAGTTAAATGTGCTAAACT
TTAACACTGTAAGAACAAAATACTACTCCAAGCTGTTTGC
TTTTGAGTTCATGGTGTGTTGACATTTAACCTCCTGTTGT
TAAACTAACTAAAGTAAAGCCTAAATAAGATTAATCTAAA
ATTTAAAGGTAAACTGCACAGATGCATTTAGGATATCGTT
TAAAAGTATACATTTCTTCCAAAAATGGGCACTGAAGCAA
ATGCACAAATTATTAAATGAATTACTAAATATTGATCTTA
ATTTATCACTTTACCATTTTTAACACTAAAAATGATAACT
CATTCCTTCAGCAATGCTAAATATTTTATATATTTCCAAG
TTTGTCCTTTTACCAAAACCTTTCCAACATGCTTAGCTAT
AACATCCTGTTCATTTCAGAGAAGCTGGCACTTTTATTTC
AGTTGAATAATTGTAGTGTAACAGTATATAAAACCTGTTT
TAAATGTGATATATTATGACCCAATCTCTCCTTGAATACA
CATACATTAACTATTTGTAGTCAAAGGGCTTATTCACTTC
TATTTGTGTGTGGCAGCAGATTTGGAGTTTTGGTTTTGTG
CTATCTAGGGGTCCCAAATAACACATGAATATTTCTAAAA
AGCGTCATCTTGCTTGAGTCAAATGTACTGTGAAAAACAG
GTTGGAATGTTTTATTACACAGACTGAATTGTGTACTTTA
TTATAACTTATTGAAATTTTATTGTAACTTATCCAGTGTA
ATTAGATTTTCTATTGTACATTTTAGTTCATTTAGGGTGA
ATGAGGAAATAAATACTCTAAAAGGGCTGGAAAGGATCTG
TGTTTCAAACTGCAGGTCTTTGCGGCTACTCTGTGGATAT
GAGAATACTCACCCTTTTATGAATGGTTTTGAATAAGCAC
ATCCATGTGGAAGTAACTGTTGAGCTTGACAGTTTATTGC
CATATTATTCTGGCATCTACCAAACAATTTCTCTTTCATT
TTGCAGCTAAAATGTTTAACTCTGCTGTTTTTAATCCAAA
TATATGTTACCTGTGAAATATGCAAGATTTTCCTCTTATT
TTATCACTAACAGTCAGTTATCATCCCTAAAAAGCTGTAT
TTGTGTGGTAAGCTAAGCGTGGGGCAATGATGCTGAAATA
TCAACAGCTGATGCCTCATTACTCTTGACTGACTTTGAGT
GCTAAAAAAGCAAGTCATTTTTATATAAACCTCTTTCTTG
TACACTTAGTCTAAATGTCTTCATTTTAATCTGTATTTGG
AACGCCTCTTGGCAAACGCTGAGTTTTCAGATGTTCGAAA
GGTGTAAAGCCAAATTATAGAAGGATGTTCAAAATATCGA
GGAGGCAACAAATGCTGGGGCCACTGATGTGATGTAATGT
ATTATTACAACAGATAGTGTGGTGATACAAGTGTCCAGTG
AAAGATGCAAACTGAACTTCAGTGTAAAATGTTGTTTCTG
TTACATTAATAAAATCTATTTTTGTAGACCTCTAA

ralab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ralab-201 2835
ncRNA ralab-002 (1)    Ensembl 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ralab-201 Contained in:
[BAC] CH211-202I17 (1)

Genome Resources: Vega_Trans:OTTDART00000027373 (1),  Ensembl_Trans:ENSDART00000027587 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC085637 (1) 2608 bp
GenBank:CN500110 (1) 868 bp
GenBank:EB935049 (1) 386 bp
CITATIONS (2)