Transcript

fbxl18-201

ID
ZDB-TSCRIPT-090929-9898
Name
fbxl18-201
Previous Names
  • fbxl18-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027336 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027336|OTTDARG00000021469|ZDB-GENE-050913-65 fbxl18|OTTDARP00000022387 fbxl18-001 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 2626 bp
GTGCTACACTATATACTGAACATACACCATTGATATACAC
ATATTACCGCTATGCGTGTGCCAGATTTTACAGTATCAAC
AACTGTTATACGTTTATTGAGATGGCAAGAATTAGTTTTT
CTATATTACTGAAGTACACATCCCAACACCTTTCCCAAAA
GCGCCATGAATAATCAAATTGAAACGGCTCAGTGCTTCTC
AGACAACATTTCTCAGGTCTCTGTCACCATCTCTGACTTC
TCAGATGAGATTTTACTGAATATCCTGCGATTCATTCCCA
GCCATGACCTGATACTCAACGTAAGTCGAGTGTGCAGAAA
ACTCCGAACTCTCTGTCTGGACAAGAGCTTGAGAGTCCAT
GTACACCTGCATAAAGAATACACGGCAAACGACGATGCTG
TGAAGCAGCTCTTAAAAGTAATTTCAGCTGACATCCAGAC
GTTAAACCTCAATGGCTGCTACTGGCTGGCCGGCTCTACA
GTGGATCAGGTCACCCGCTGTAAGTCTTTGGTCAGTTTGG
ACCTTTCCGGCTGCAGATTGACATCAGTTCGCCTCTCGCA
TCTGCTGAGCTCTCTTAGCTCTCTGAAGTCTCTGGCACTG
GATGTGGGGCCGGGGTTTGATCTCCACCAGCTGAGCGCAG
AGGGTAAGTCTGCTCTGGCTCGTCTGCAGGAGCTCAAGCA
GACGCTGTTGACTCCTTCCTATGGCGTGGTTCCCTGCTGC
AGTGCCCTGCGGCGCCTTCACCTCTATCTAGAGGCCAGCG
AGGTCTGGAGGGAGGCCGGCGGCTGTGCGCAGCTGATGGT
GGGCCAGAGCAGCGTGCCGCACTATCAGAATCTGCGCTGG
TTCTCCGCTCGCCTCGCACCCGGTGAAGTCAACCGTACTC
TGTTGGCGCTTTACTTAGCTGTTTTCAGTATGAGAGTTCC
TGAAGGCCTTGCAGGATTGGTACTCTCTGTGCCAGGCCCT
GCACCGCCACGACCAGTCGCAATGACGGCGCTAATGGAAA
GCATGGCGTCAACTGTGGGAAATACTGTTAGTGCTTTGCA
GCTTCCACGTACATGGTTGGACGGTGCTATACTTGGGCGG
GTGTTAGCGCATGGATGTCCTGCATACCTGAATGTCTCCC
GGTGTTCATCTCCAGGGTTCAACCCTTTACATGTGCTACT
CAGTGCGGGACGTGACCTCACACCCCTGCGGAGCCTCAAC
CTGCGGGGATGCGGTCGAGGCCCGCTCTCTGAGAGCTGTG
GGAAGGGCGATGAGGAGATGGACACGGACAGCGTCAAAGC
ACTTGCTGAATGTTGCCCACATCTTAATCACCTTAATTTA
TCTGCAACGCACTACCATCATAATCTCTCCACGGGGCAGG
ATGGACACTTGTGTGGTACTTTGGGACGCCTCACTGGCTT
GTGCTCGCTTGCACTTCCGGTGTGTGCATTAGCACAATCT
CCTCCAACTCAAATAAACAATCAAGACTCCAACACAGACC
TCGCCTCAAGATCACTGCTGCTCGGGCTTAAAAAGACCAC
CCGCATTGGTGTGCCCACATATCGACCCACATCTGAAATC
GCAGTGGGTCAGGGGGAAGAGCGGACAGACCGGGGCTTGT
GCATTCAACCACTGCTTCAAGGTTGCCCGTATCTAGTAGA
GCTGGAGCTGATTGGTGCAGGCTTTTCCTCAGCCATGCCC
CGGAACGAGCCGGCCATTCGCAAGGACCCCGCTGCATGTT
CCTGGTCCTACAGCGTTGGAGATGGGGAGTTAGCTGCTTT
AGGTGGGATGAAATTTTTGCGCAAGCTCACCCTCGCGCAT
TTACCAGGAGTTCTGAAGGGGACGGGACTCATCGAGCTGC
TTCAGGGGTGCAAGGACCTGCATTCCTTATCGCTGGCAAA
TCTAGGATCTTTAAAGACCATGAACTACACGCAGGCCCTG
CTGGAGGCTCTTTCCTACTGCACACAAGTCAGGGACTTAA
GGCTGGAGCAGCCCTACTTTAATGCAAACGCAGCGTTTTT
CGAAGCGCTCAGTCAGTGTGGTCAGCTGCGGCGTCTGTGT
TTAGTTTCTCGACACGGCACTTTCCAACCCGCCGCTGTGA
CGGCCTTCATGCAGAGCTGCTCTGTCATCATGTGCCACAT
GTTCATGGGAGGAACGCTGGTGGCCTGTAAAACGCTGCAG
AAAACCCTTCTGGACAGTTTTTCAGTGTCTCGTCCAGCTC
TTAGTGTGGTGATTTACCCTTTACTGCATGAAGACCTGGC
CCATGTGATCAGAGGTATGCCACTGTGCCACCTGGACGAA
ATGACACTTTTTAAAAGTCGTGTTGCTGAAGAGCCCATGA
GTCGGTGACTGTGGAAATATTGACGAAAAAAGAGAATCAT
TCTTTGGTGGATTAACCTGGGTCATACATCTGTGCTGTTT
TTGAGAGTGTATTCATAATTGTGCATTATGGAAAGTCTGC
TTTCTGATAATGAAATATTAGCAAACCGGTTGAAGGATAA
TTGGAAAACTTTTTTTTTTTTACTTGAGAGATCATATGGA
CTATCATAGCTTTCCTAATAAGCTCATTGTTTACCAGTAA
AGAGGCAGTATGAACAAGCTCTATGTCAGGTTATAATGTC
ATCTTTGGATATGTGCCAAAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations