header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9756
Transcript Name: smpx-201
Previous Name: smpx-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027185 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027185|OTTDARG00000021392|ZDB-GENE-040704-24 smpx|OTTDARP00000022272 smpx-001 LG_ BX537285.6 Danio rerio protein_coding KNOWN, 2436 bp
GAACAGTCAGAGTGGACAGAAAGCAGGTCTCCTCTGTGTA
TCACACGACTATTTATAGTGTGAACAAATCCCAGATATGA
ACGGAATCCCCTGCTCCTCCACAGCCTAGAGAGAGGAACA
GAAAAACAGACAGAGAAGGTGCTGAACAGAACCAGAACCA
GACCTCAGAAGACAAGACAAAGACAGAAACAGAAGAGAGA
GAGATTGACATTTGTGTCTGACACCAGGGAACAGCACTTT
CCTTTTAACACCAGCAGCAGGAACGTGGACACAACTGCAC
ACAATGTCAAAACAGCCGTCGTCCAACGTCAAAGCCCTGC
AGGCCAACCTTAATATCCCGATGGGGGCTCTGCGTCCTGG
AGCGGGACATCCTGTGAAGAGGAGAGAAGATACAGTAGAA
ACAGAAGAGGTGTCTCCAGTCACTCCAGAAGAGAAGAAGC
CTCTGCCTGGAGCTGTGAAACTCCCTGGTCCCGCTGTCAA
CCTCTCCGAACTCCAAAATGTAAAGAGTGAACTCAGATGG
GTCACCAAAGACTAAATTGGCTCAGGTGACTCCTGCCCCA
TTTTATCCAAGGCTTTGCTTACAATCTCCATCCAATCAGA
TTCATGTATTCACCACAAACTCCTGGTCACAATGGAATTA
ATGAGAAGCCTTAATGATGACACTTCCAACTGATTGAGGA
TGAGGAGAGGGGGCGGATTATGTCGGAGCAAAGACTGATG
TGAATTGAGCAATTCGAATCTCTGAACCAGGGTTTAGTGT
GTCTAAAATAGGTCATCGTGTTTAAACCTTCCTGTATCTT
GTTTTTGTGCTTTAAAATGTACCATGTGCTCAACTTTAAG
GGATGGTTCACCTTAAAATGATAATCTTCGTGAGTAAACT
CTTCCTTCAAGATAGGTTTTTTAGAAGCTCTGTGTTCTGA
AACTAGCATCATAAAAAAGATTACACAAGACTGAAGGCAT
TTCTAAAAATTCCTCAATTCTCCTTGAAAAAGACCAGATT
GTGACTTCTCAACAAGATCTCGAACAAATTTGACAGCATA
AAATACATTTAATTCCAATACATTTAACATCTAGATTGAT
TAATATGCAAACGCTTGAGATAAATTTGATTAATTAGCTG
GAATGTCATGCATTTAATTTGATTAATTTTCATCCGCGCC
CCATGCTTCAGGCTTGTCTTGCTCCCTACACATCTTTTAT
ATTCTTTATCTACGGCTTTGTTCTTGTGTGTTGCAGTACA
TGAGTAGGCTGTTGCATAATAAAACATGATTTCACATTCT
CTCCAAGAGCAAAATCGTAGGAGGAAGCCAGCACTTGTTA
TCCTTGAACAAATAGAACTGGATTTCAAACGGCGCACCAT
CAGTTTGTTATGTACATAAACTGGGATCAGTTTAAAAGGG
TAAGGCTGCTCATCTCCTTGCCTAAATCACATCATATGGT
CTGTACTGCTCTGTGATATAGTTTACTAGCAGCAGTCGGT
GTCAAGACCTTTGGGTGAAAGTGTCCTTATTTAAATATTG
TGTATTGCTTCTTCAGGTAACACTTTTGTTTGGTATTTGA
CTCCAGAAATAGCAATAGCGGACTAACGGACGTTAAGTGC
ACAAGTTCTTCACAAACTACTGACCCGGCAAGCCTAATGC
AGCTTTTTAGTCATTATTGTGAATGAGGATGGTAAAGATG
TTAAAAGGGATACAGCTGAGGAAACATAGCATCATTTTTG
TTACCCTGCACAACAATATTTAATATTTTTACATTACTGT
GTGAGGTAGGTTTAGGGTAGAAGTGGGGGTAAATGTTAAT
TAAATACCATTATTAGGTAATTTAATAAATAATGTGTTCT
TGTTAACGTCCAGCCACCGCTGCATCCCTTCTAACAACAA
CCAATTGGGGATCTGTTGTCTGATCAACTTAAAAAAACTA
AGCATAATGGAGAAACTTTTCTATTTTGAAGTACATAATT
GTTGTATAAATGTACCCTTACTGTAGCTCAGAGTCAGTCT
GCAATAAAGGAACACTCCCAATATGTTTTACAAGTCACCT
AGAGTCAAACAGTTGAGTTTTACCACCTTTTAATCCATTT
GAAATCTTTATTTTTACTCATTTTAAACGAGATGCTGAAC
CCATGCAATAATATATGCTAAGCTAAGCTAAAAGTGCTCC
TGCCAGACCTGAAGATCGCCTGGATGGGAGAAAAAATGGT
AAAATATCAACTGCTTTACTTTAGGTGACTTGTAAAATGA
GATTTGCAAAAAAAAAAAGTTGAATGTTCCTTTAAGAGTG
ACCAGTTAAAATCTGGGGAACACGTTTATGTGTAAAGAAG
ATAAATTGTGTCTGCTTATGAATTTCTTTCATGTGTGAGG
CTCTTTTTTCTGTAAGGTTCCTTTGAAACAATGTGTATTA
TGAAAAGTTCTATATAAATACAAATGTCTGATTGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smpx-201 Contained in:
OTHER smpx-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027185 (1)
  • Ensembl_Trans:ENSDART00000066625 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC074039 (1) 2285bp
    GenBank:CN179146 (1) 808bp
    GenBank:EB888886 (1) 667bp
    GenBank:AL916542 (1) 519bp
    GenBank:EB830456 (1) 429bp
    CITATIONS (2)