Transcript

smpx-201

ID
ZDB-TSCRIPT-090929-9756
Name
smpx-201
Previous Names
  • smpx-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027185 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027185|OTTDARG00000021392|ZDB-GENE-040704-24 smpx|OTTDARP00000022272 smpx-001 LG_ BX537285.6 Danio rerio protein_coding KNOWN, 2436 bp
GAACAGTCAGAGTGGACAGAAAGCAGGTCTCCTCTGTGTA
TCACACGACTATTTATAGTGTGAACAAATCCCAGATATGA
ACGGAATCCCCTGCTCCTCCACAGCCTAGAGAGAGGAACA
GAAAAACAGACAGAGAAGGTGCTGAACAGAACCAGAACCA
GACCTCAGAAGACAAGACAAAGACAGAAACAGAAGAGAGA
GAGATTGACATTTGTGTCTGACACCAGGGAACAGCACTTT
CCTTTTAACACCAGCAGCAGGAACGTGGACACAACTGCAC
ACAATGTCAAAACAGCCGTCGTCCAACGTCAAAGCCCTGC
AGGCCAACCTTAATATCCCGATGGGGGCTCTGCGTCCTGG
AGCGGGACATCCTGTGAAGAGGAGAGAAGATACAGTAGAA
ACAGAAGAGGTGTCTCCAGTCACTCCAGAAGAGAAGAAGC
CTCTGCCTGGAGCTGTGAAACTCCCTGGTCCCGCTGTCAA
CCTCTCCGAACTCCAAAATGTAAAGAGTGAACTCAGATGG
GTCACCAAAGACTAAATTGGCTCAGGTGACTCCTGCCCCA
TTTTATCCAAGGCTTTGCTTACAATCTCCATCCAATCAGA
TTCATGTATTCACCACAAACTCCTGGTCACAATGGAATTA
ATGAGAAGCCTTAATGATGACACTTCCAACTGATTGAGGA
TGAGGAGAGGGGGCGGATTATGTCGGAGCAAAGACTGATG
TGAATTGAGCAATTCGAATCTCTGAACCAGGGTTTAGTGT
GTCTAAAATAGGTCATCGTGTTTAAACCTTCCTGTATCTT
GTTTTTGTGCTTTAAAATGTACCATGTGCTCAACTTTAAG
GGATGGTTCACCTTAAAATGATAATCTTCGTGAGTAAACT
CTTCCTTCAAGATAGGTTTTTTAGAAGCTCTGTGTTCTGA
AACTAGCATCATAAAAAAGATTACACAAGACTGAAGGCAT
TTCTAAAAATTCCTCAATTCTCCTTGAAAAAGACCAGATT
GTGACTTCTCAACAAGATCTCGAACAAATTTGACAGCATA
AAATACATTTAATTCCAATACATTTAACATCTAGATTGAT
TAATATGCAAACGCTTGAGATAAATTTGATTAATTAGCTG
GAATGTCATGCATTTAATTTGATTAATTTTCATCCGCGCC
CCATGCTTCAGGCTTGTCTTGCTCCCTACACATCTTTTAT
ATTCTTTATCTACGGCTTTGTTCTTGTGTGTTGCAGTACA
TGAGTAGGCTGTTGCATAATAAAACATGATTTCACATTCT
CTCCAAGAGCAAAATCGTAGGAGGAAGCCAGCACTTGTTA
TCCTTGAACAAATAGAACTGGATTTCAAACGGCGCACCAT
CAGTTTGTTATGTACATAAACTGGGATCAGTTTAAAAGGG
TAAGGCTGCTCATCTCCTTGCCTAAATCACATCATATGGT
CTGTACTGCTCTGTGATATAGTTTACTAGCAGCAGTCGGT
GTCAAGACCTTTGGGTGAAAGTGTCCTTATTTAAATATTG
TGTATTGCTTCTTCAGGTAACACTTTTGTTTGGTATTTGA
CTCCAGAAATAGCAATAGCGGACTAACGGACGTTAAGTGC
ACAAGTTCTTCACAAACTACTGACCCGGCAAGCCTAATGC
AGCTTTTTAGTCATTATTGTGAATGAGGATGGTAAAGATG
TTAAAAGGGATACAGCTGAGGAAACATAGCATCATTTTTG
TTACCCTGCACAACAATATTTAATATTTTTACATTACTGT
GTGAGGTAGGTTTAGGGTAGAAGTGGGGGTAAATGTTAAT
TAAATACCATTATTAGGTAATTTAATAAATAATGTGTTCT
TGTTAACGTCCAGCCACCGCTGCATCCCTTCTAACAACAA
CCAATTGGGGATCTGTTGTCTGATCAACTTAAAAAAACTA
AGCATAATGGAGAAACTTTTCTATTTTGAAGTACATAATT
GTTGTATAAATGTACCCTTACTGTAGCTCAGAGTCAGTCT
GCAATAAAGGAACACTCCCAATATGTTTTACAAGTCACCT
AGAGTCAAACAGTTGAGTTTTACCACCTTTTAATCCATTT
GAAATCTTTATTTTTACTCATTTTAAACGAGATGCTGAAC
CCATGCAATAATATATGCTAAGCTAAGCTAAAAGTGCTCC
TGCCAGACCTGAAGATCGCCTGGATGGGAGAAAAAATGGT
AAAATATCAACTGCTTTACTTTAGGTGACTTGTAAAATGA
GATTTGCAAAAAAAAAAAGTTGAATGTTCCTTTAAGAGTG
ACCAGTTAAAATCTGGGGAACACGTTTATGTGTAAAGAAG
ATAAATTGTGTCTGCTTATGAATTTCTTTCATGTGTGAGG
CTCTTTTTTCTGTAAGGTTCCTTTGAAACAATGTGTATTA
TGAAAAGTTCTATATAAATACAAATGTCTGATTGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations