Transcript

rpl21-201

ID
ZDB-TSCRIPT-090929-9714
Name
rpl21-201
Previous Names
  • rpl21-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027134 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027134|OTTDARG00000021364|ZDB-GENE-030131-8512 rpl21|OTTDARP00000022237 rpl21-001 LG_ AL929009.5 Danio rerio protein_coding KNOWN, 617 bp
GTCCTCCTATTCGCGTACTGAAGGAAGAGCCGCAGGACCC
TATCATTCTCTTTCCGCCGTACCCGCCATCTTGCGAGCAA
CCGGGGTAATCAGGCATCATGACTAACACCAGAGGCAAGA
GGAGGGGGACCAGGTATATGTTTGCCAGGCCCTTCCGCAA
GCATGGCCCAATCCCTCTGTCCACGTACATGCGCATCTAT
AAGAAGGGTGATATTGTAGATATCAAGGGCACAGGAACCA
TCCAGAAAGGCATGCCTCATAAGTGCTACCATGGCAAAAC
AGGACGTGTTTATAATGTTACGCAGCATGCTGTAGGCATC
ATTGTCAACAAGCAGGTCAAGGGCAAAATCCTGGCCAAGA
GAATTAATGTGCGTATTGAGCATATTAAGCACTCAAAGAG
CAGAGACAGTTTCCTGCAGCGCGTCAAGGAGAACGAGAAG
AAGAAAGTGGAGGCCAAGAAGGAGGGCACCTGGATTGAGC
TGAAACGCCAGCCTGCTGCTCCACGGCCAGCACACTTCGT
CAGCACTAAGAACAACAAGCCTCAGCTCCTGGAGCCCATC
CCATACGAGTTTATGGCATAAATCTGCTGACCAAAATAAA
CTTCTTTGTACCACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations