ZFIN ID: ZDB-TSCRIPT-090929-9704
Transcript Name: snai2-201
Previous Name: snai2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027124 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027124|OTTDARG00000021356|ZDB-GENE-030326-6 snai2|OTTDARP00000022229 snai2-001 LG_ CR354603.12 Danio rerio protein_coding KNOWN, 2992 bp
GTGTTAGAGCAGATCAGCGCTGGAAGATGAGGCTCTGCTG
GAACGAGCAGTGAGGATTACAGTGATTTGACTTGCTAAAC
GACAAGACAGGACCATTTTTTATCTGCCAGACAACTTTAT
ACGTACTTCAGCATGCCTCGTTCATTCCTAGTAAAGAAGC
ATTTCAATGCAGCTAAGAAACCGAATTATAGTGAACTGGA
GAGTCCGACAGTGTTTATTTCTCCATATGTCTTAAAAGCC
CTCCCGGTGCCTGTTATACCTCAGCCTGAAGTGTTAAGCC
CGGTGGCGTACAATCCCATAACAGTATGGACTACCAGCAA
CCTGCCACTGTCGCCCCTTCCCCACGACCTGTCCCCCATA
TCCGGATACCCCTCATCTCTCTCTGACACATCCTCTAATA
AGGACCACAGCGGTTCGGAGAGCCCCAGAAGTGACGAAGA
CGAGCGGATACAATCCACCAAGCTGTCGGACGCTGAGAAG
TTTCAGTGCGGTTTGTGTAACAAGTCCTACAGCACGTATT
CGGGACTCATGAAGCACAAACAGCTGCACTGCGACGCACA
GAGTCGGAAATCGTTCAGCTGCAAGTACTGCGAGAAGGAA
TACGTGAGTCTAGGAGCCCTAAAGATGCACATAAGGACAC
ACACGCTGCCGTGCGTTTGTAAAATGTGTGGAAAAGCTTT
CTCCAGGCCTTGGCTGCTGCAGGGACACATTAGAACACAC
ACGGGTGAGAAACCGTTTTCCTGCCCCCACTGCAGTCGTG
CATTCGCAGATCGATCGAACCTCCGAGCCCACCTGCAAAC
CCACTCAGACGTGAAGAAATACCAGTGCAAGAACTGCTCT
AAAACATTCTCTCGCATGTCGCTGCTGCACAAACATGAGG
AATCTGGCTGTTGCATCGCACACTGAGAGGCCTGCATTCA
ACAAGTGCCTCCGATTGGGAAGACTGATCTCAGACCTGTC
AGATTCAACTGGAAAGGAAGTGCAAAATGCATCGCAAAAG
ACGATTTCAAAATGCACCTCCCCAGGGTCTGAATGAATCA
AATGTTTGTGTTGAGTCAGATTCCAACCAAGATGCTACAC
GTTGAAGGGATAGTTTGCCTAAATGAGAATTTAATCACCA
TTTAATCACCCTTTATTTGTTCCAAACGTTAATGACTTTT
GAACCATTGACTGATTTGTTTTTCCTACTATGGAAGTCAA
TGGTTACAGATTTCAAAATGGTTACATTCTTCAAAATATT
TTCTTTTCTGTTCCACCATAACCAATTGGAACCACTACAA
ATCCTGTTATCATTGACTTCCATTTGTTTTTTTGTTTTTT
TACTATGTAAGTCAAGGGTTACAGGTTTCAAACATTCTTT
AAAACATCTTTTGTGTTCAACCATAACCAATTGGAACCAC
TAAAACTTGTAACCATTGACTTCCATTTAATTGTCTTACT
ATAGAAGTCACTGTAACCATTGACTTTCATTTGTTTTTCC
TACTATGGAAGTCAGTGGTTACAGCATTTAAACATGCTTC
ATAATATCTTCTTTTGTGTTTGACCATAACCAATTGCAAC
CATTACAAAACCTGTAACTATTAACTTCCATTTATTTTCC
TACTATAGAAGTGTCTGTAACCATTGACTTCTATTTGTTT
GTCCAAACGTGGAAGTCAATGGTTACAGGTTTCAAACATT
CTTCAAAATATCTTCTTTTTGTGATCAACCAAAACCAATT
GGAACCAAAGCAAAATCTGTAACCATTGACTTCCATTTAT
TTGTCTTACTATAGAAGTCACTGTAACCATTGACTTCCAT
TTTTTGTTTTTTGCAAATGTGGAAGTCAATGGTTACAGGG
TTTCGAACATTCTTCAAAATATCTTCTCTTTGTGATCAAC
CATAACCAATTGGAACCATTACAAAACCTGTAACTATTGA
CTTCCATTTATTTGTCCTACTAATGAAAGGCAATGGTTTG
AGGTTTTGAACATGCCTCAAAATATTTTCTTTTGTGTTCA
ACCATAACCAATTGGAGCTATTACAAAACTGGTAACAATT
GACTTCCATTACTTTTTCCTACTATAAAAGTCACTGTAAC
CATTGACTTCCGTTGCATTTGTTATTCTTATTATGGAAGT
CAATGGTTACAGGTATCAAACATGTCTCAAAATATCTCTT
TATTTTTCTACAAAACCATTGACTTCCATTGCATTGTTTT
TCCTATTATGGAGGTCAATTCGGGTTTTGAACATACCTTA
AAGTAGCTTCTGTTGTGTTCAACTAAAACCAATTGGAAAC
ACTAAAGAGAGAGTAAACAGTGAGGAAATTATCATGTTTT
TGCGTGAACTATCCCTTTAATTAAAACTGACCCAAGACTC
TGAGCTGGTTGCTGGAGAACCTTCAACACCCTCATAAAAG
AAAAGACTGTTTGCAGGAACTCATTCATTTCAGTGCAAAC
GCAGATTGTCATGCGGACACCATCATGTGCCTTCCATTTC
AACAGTATTTGCCCTGTATTTGGGGGTTGAGCTGATGCGT
ACTGTACATTTGTTTACGAGTATGTACTATTTGGGAGGTT
TTTTTAACACTCGCCTCTCTAAAAAAGCAATAATTTATAG
TGCGACCGAATGTTAATTGACGGTCACTTGTATTTTAAAC
ATTTTTGGAGAGGTAATCGGTCAGATATTTCAACCCAATG
AGCTTGAGACCAAAGGAATAATTAATGCCATGTTTTTTTA
TTAATAAAACGGGGAACAAGTGCAAAGTGATGTTTTCTTG
AACTACAAGTATTTAAGCTGTTGTGTGGTCAAACGCAACA
GCAGTCAGCCAGCACTCAGACATGCAATACTTCTGCCATG
TGCCTTTATTTCATCAGGAACTTCAGAGATTTCGCCATGT
AATTGTTTTTTTGAATGTATATGACACTGATATGATTGTA
CTTTGTATTGCAAAGTGTAAATGGATGGTATGATTTTGTA
CAAAAATAAAATGTACGCTTTTTTTAAATACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snai2-201 Contained in:
OTHER snai2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027124 (1)
  • Ensembl_Trans:ENSDART00000058571 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC086969 (1) 3005bp
    GenBank:CB333804 (1) 1888bp
    GenBank:DR726538 (1) 791bp
    GenBank:AI722148 (1) 579bp
    CITATIONS (2)