Transcript

kif1b-204

ID
ZDB-TSCRIPT-090929-9684
Name
kif1b-204
Previous Names
  • kif1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027103 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027103|OTTDARG00000021340|ZDB-GENE-030820-1 kif1b|OTTDARP00000022213 kif1b-001 LG_none CR381616.9,BX571850.7 Danio rerio protein_coding KNOWN, 4012 bp
GTCAAACGACACCAGAACCTGCCTCAGAAAATAAACCCTA
ATCGCAAGCATTTTGTGCAGCGCTGGCGAATGAAACGCAG
CTATAATGGGTGTTTATAACAAGAAAGGAACTATTAAGAA
CTTAATCATCAGTCTTTTTTGATTTTTGCTGCTGGTTGCA
GACGTCATTTGAGAATTGGCATCGTGCAGGATTTCTATGG
TGTTCTAGACGTGTATTGTGGATAAATAACGAAGAAACAT
TTTGTGGGATTGAATCGCAACAGCTTCAACCATGTCTGGC
GCCTCAGTGAAAGTGGCTGTCAGAGTTCGGCCCTTCAACT
CAAGGGAGACCGGCAAAGAATCAAAATGCATTATACAGAT
GCAAGGGAACTCCACCACTATTTTGAACCCCAAGAACCCA
AAGGAACCCAAAACCTTCAGCTTTGACTACTCCTACTGGT
CTCACACCTCACCGGACGACCCCAGCTTTGCGTCACAAAA
CCAAGTCTACAATGACATCGGGAAAGAGATGCTGCAGCAT
GCTTTTGAAGGATATAACGTCTGCATTTTTGCATATGGCC
AGACTGGAGCTGGCAAGTCCTATACCATGATGGGAAAGCA
AGAGGAAGGACAGGAAGGCATTATTCCTCAGCTCTGTGAA
GAACTCTTCGAAAAAATCAATGACAATAACAATGAGGAGA
TCTCGTACTCGGTGGAGGTGGCTTATATGGAGATATACTG
TGAGCGGGTGAGGGACTTGCTGAACCCTAAGAACAAAGGG
AACCTTCGTGTCCGGGAGCATCCTCTACTTGGGCCGTATG
TTGAAGACCTCTCGAAACTGGCTGTCACCTCGTACACCGA
CATAGCTGACCTGATGGATGCTGGTAACAAAGCCAGAACT
GTCGCTGCAACCAACATGAACGAGACGAGCAGTCGTTCTC
ACGCCGTCTTTACTATCGTTTTCACTCAGAGGAAGTACGA
CAGCGAGACGGACCTCTCCACCGAGAAGGTCAGCAAAATC
AGCCTGGTGGATCTGGCAGGAAGTGAGCGTGCTGACTCAA
CAGGGGCCAAAGGAACCAGACTAAAGGAGGGAGCAAACAT
CAATAAATCTTTAACTACACTAGGAAAGGTGATTTCTGCC
CTGGCTGAGGTGAGCAAGAAGAAAAAGAAGACCGACTTCA
TTCCTTACCGAGACTCAGTGTTGACATGGCTGCTAAGAGA
GAATTTAGGAGGCAATTCGAGGACCGCAATGGTGGCTGCA
CTGAGCCCTGCTGACATCAACTTTGATGAAACGCTCAGCA
CACTCCGATATGCGGACAGAGCCAAGCAGATCAAGTGCAA
TGCTGTCATCAACGAGGACCCCAATGCCAAACTGGTGCGG
GAGCTGAAGGACGAGGTGTCACGGCTGAAGGAGCTACTCC
GTGCCCAAGGCCTCGGGGACATCCTGGACATCGAGCCAAT
GGGGGATGATTGCCTTGGAAGTGGAAGCAAATCACCCATG
GGCTGTCTGACAGCCTCTCCATCTTCAGGCTCTCTCTGCA
GCCAGGCAGGCCTACAGTCCGTCTCCAGCATCCAGGAGCG
CATCATGTCCACGCCAGGCGGAGAAGAGGCCATCGAGAGG
CTCAAGGAATCAGAAAAGATCATAGCCGAGCTGAATGAGA
CCTGGGAAGAGAAGCTGAGGAAGACCGAGGCCATCCGTAT
GGAGAGAGAGGCGCTGCTGGCAGAGATGGGAGTTGCCATA
CGGGAGGACGGGGGAACCCTGGGCGTCTTCTCTCCTAAAA
AGACGCCTCACCTGGTGAACCTGAACGAGGATCCTTTGAT
GTCAGAATGTCTGCTCTATTATATCAAAGATGGAATAACA
AGGGTGGGCCAGGCAGATGCTGAAAGAAGACAGGATATCG
TTCTAAGTGGAGCTCACATTAAAGAGGAGCACTGTATTTT
CCGCAGTGAGAGGAATGCCAATGGACATGTGATTGTCACG
TTGGAGCCATGTGAGGGATCAGAAACATATGTAAATGGTA
AACGTGTGAATTCTGCGGTCCAGCTGCGCTCAGGTAACCG
CATTATCATGGGAAAGAACCACGTGTTCCGGTTTAACCAC
CCTGAGCAGGCTCGCGCTGAGCGTGAGAAGACCCCGTCAG
CAGAGACACCTGTAGAACCTGTTGACTGGACTTTTGCCCA
AAGAGAACTGCTGGAGAAACAGGGTATCGACATGAAGCAA
GAGATGGAGAAGAGGCTTACAGAAATGGAGATCCTGTACA
AAAAAGAGAAGGAGGAAGCGGACCAGCTACTGGAGCAACA
GAGACTGGATGGGGACTCTGATAGTGGTGATGACTCTGAT
AAGCGGTCATGTGAGGAGAGCTGGAGACTCATCACTTCTC
TACGGGAGAAGCTTCCTCCCAGCAAGCTCCAAACCATTGT
CAAAAAGTGCGGTTTACCCAGCAGCGGTAAAAGACGAGAG
CCTGTCAAAATGTACCAGATCCCTCAGCGTCGTCGCCTTA
CAAAAGACTCCAAATGGGTGACCATCTCAGATCTGAAGAT
CCAGGCAGTCAAAGAAATTTGCTATGAAGTGGCACTGAAT
GATTTCCGTCATAGCCGCCAAGAGATAGAGGCTCTAGCCA
TAGTAAAATTGAAGGAGCTTTGTGCCACCTACAACAAGAA
AGACCCAAACGAACGAGATTCTTGGAGAGCAGTAGCTCGA
GACGTCTGGGACACTGTAGGAGTCGGGGACGAACGAATCG
AAGATGTCATAACCAACGGTAGAGGTGTGGCTGATATGGA
TGACCTGAAGGTGCACATTGACAAACTAGAGGACATCCTG
CATGAGGTAAAAAAGCAAAACAACACGAAAGATGAAGAGA
TCCGAGCTCTCCGCACTAAGATGTTGAAGATGGAGCAAGT
GATCCCACTGATTTCCAACGAAAATCTGTCCCAGGAGAAG
ACCTCTCGTGGCGGACCCATGAGGGCCCGCAGTTCCAGCG
AGGGTAAAGCTCTTGAGGAGAAGCCCAGTGACGAACAGTC
AGATGATCAGATGTGCAAGATGGTAGACGACGATTCTTCG
TTTCGACGTGGGCGCATGAGGTGGATGCGACAAGAACAAG
TGCGCCTCAAGAACCTCCAGCAACAGGAAATTTCCAAGCA
ACTCAGAAGGCAAACTGGACCTCACAGATTCATCCCACCT
GAAGACCGCAAGCTGCGCTTCCCCTTTAAGAGTAACCCTA
AACATCGCAACTCCTGGACTCCTGGCACCCATATTATTAT
CACCGATGAACAGGTGATTGAATTAAAAGTTCCCAAAGAA
GCAGTCCAAGAAGAGAACGATGACACCGAAGAGTCTGTAG
AGCCCAGACCACAAGTGGTCCCCACTATCCAGACATATCC
CCCTCTTCCTAGTCCCATGGGTCAACGTAAAAGCAAAGAT
CTAGAGCAAGGTGTGAGTCATAGACCTAATCAAAGCCAGA
AACTCCACGAACGAGGTCGTAGTAACTCCTTTAACAGCAG
CCAGCGAGCCTCGGACTCTACAGAGACCTTCAATTCTGGA
AACCGGAAGCCCCCTCACCCCCAACAGGCCTTTTACCAGC
CACGCTACAACCAAAACCAGCATTATTATCCACCACAACC
GCATCCACAGTTCTTTCATTACAATACTGATGCCGGCTAC
CAGCAATACCCACCCAATCAGCAGCACAGTCACCACAACA
ATTTTAACACGCCACCCCGTATGCGTAGGCAATTGTCTGC
CCCCAATTTGAAGGGCAGTCGAGAAACCGCAGTGTGACAT
TGAAAGCAGGGCTATAGGTTCATGTACAAAACTAGCTGAC
GCTACAAATCACACATTACAGACTCATCACAGCATTGGAC
AGCTTGTCCCCATCAAGTCAAACTGTTATGTGGCACTTGT
TAAAAATGATTGAATGTTTTTGTTGTCATTAATCCAAATT
GTAATGGTCTACCTGAGAAATAGCTTCGTGAGCACCTTGC
AACATTTTTATCCCCAATTTATGTTAACTATGCATATGGG
TGTTACAGTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations