Transcript

grin2aa-201

ID
ZDB-TSCRIPT-090929-9658
Name
grin2aa-201
Previous Names
  • grin2aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027071 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027071|OTTDARG00000021315|ZDB-GENE-070424-129 grin2aa|OTTDARP00000022188 grin2aa-001 LG_none CR954963.16,BX908803.8 Danio rerio protein_coding KNOWN, 9441 bp
GAGGCAATCCTCGCCGAAATCATTGAGATCACTGAAAAAA
GCAGAAGAACCACGCCGCGAAGGGTTAAAGCTTCACAACC
GAGGATGTGTTACTGACGGCATCCCTCAGTTCCAGAGAGG
CTGTGGGGAAAGAGGACTGTGAGACTGTCCTGTGGTCCTG
CTTGCAGATTCAGTCCCATTTTCTTGCGGATTCAGTTTCC
AACGTTCGAGTCTCGCGGTCCTTCTCATCGAGGAAGAGTC
ATGGATAATTCATAAACATGCAAACCACTGGATTAATTTG
ATTCGCATGGTTCTGTGGTTGAACTTCAAGGATTCGTCGG
TGGGAATAATTATCCATATTTTCAACCTGGCTGGTGAGAG
GAGGACTGTTGCAATGTCATCCCATTCAACATCTCTGGAG
CTTTGTGGAAGAGGGATGCTGGAATGAAGTCGAGCACTAT
GGGGTTTTCCAGGTTGGTTCTTCTGACTCTTCCAGCTCTC
CTTACCCTCATCAGCATCTCACATGCGGCAGAGAAAGTGC
CCATACTGAACATTGCTGTGATCCTGGGTCAGACTCGCTA
CATCTCTGACAGAGATATACGGGCTCTGTGGAGCAAAGAT
GATCCTATTGATGTCAATGTGGTGACCCTGCTGGTGAATG
AAACAGACCCCAAAAGCATCATTACCCATGTGTGTGACCT
CATGTCCGGGACTAAAATCCACGGGGTGGTGTTCGGGGAC
GGCACAGACCAGGAAGCCATTGCCCAGATTTTGGATTTTA
TTTCCTCTCAGACTTTGATACCCATCCTTGGGATCCATGG
TGGCTCATCCATGATCATGGCGGATAAGGATGTAAAATCA
ACATTCTTCCAGTTTGGGGCCTCCATCCAGCAGGAGGCGC
TGCTCATGCTCAACATCATGGAAGAGTACGACTGGCACGT
CTTCTCCATAGTGACCAGCAAGTTTCCAGGCTACCAGGAT
TTCATCGCTATCCTGAAGACCACGGTGGACAACAGCTTCG
TGGGTTGGGACCTCCAGCACATCATCACCCTGGACGCTGT
GGATGGAGACTCCAGGACCCAGATCCAGCTGAAAAAAGTT
CAATCTCCTGTCGTCCTCTTGTACTGCTCTAAGGATGAAG
CGGCGTACATCCTGGAGGAGGCCCGGTCACTGGGTCTGAC
CGGGTTCGGGTACATCTGGATCGTGCCAAGCTTGACCACA
GGTAACCCGGAGATCACTCCAGATACGTTCCCCTCTGGAA
TGATCTCCGTGTCCTACGATGACTGGGACTATCCTCTTGA
GGCACGGGTTCGAGATGGGCTTGGGATTATAACCACTGCA
GCTGCGGCCATGTTGGAAGAGTTTGGCGATATCCCGGAGG
CAAAAACCAGCTGCTATGGCCAAATGGAGAAAACCAAGTT
GCCACCCAGCGCATTGCACAAGTACATGATGAACGTGACC
TGGGATGGCAAGGATTTGTCCTTCACCGAGGACGGTTACC
AGGTGCATCCCAAACTAGTGGTGATCGTGCTGAACAAGGA
CAGAGAGTGGGAAAAGATGGGCAAATGGGAGAACCAGAGT
TTGACTTTGAAGTATCCGGTGTGGCCCCGTTTCAACTCTT
TCGGGGATGCGGAGACAGATGACAATCACCTGACCATTGT
AACGCTGGAGGAGAAGCCTTTCGTCATTGTGGAGAATGTG
GAGCGCCTCACAGGCACCTGCATGAGGAACTCTGTACCCT
GCCGCAAACACATCAAAGACAACACCACAGAGGGAGGAGG
GACGTACATTAAAAAGTGCTGCAAAGGCTTCTGCATTGAC
ATCCTCAAAAAAATTGCTCGAAATGTGAAGTTCACCTACG
ACCTTTATCTGGTGACCAACGGGAAGCACGGGAAGAAGAT
CAACAATGTGTGGAACGGCATGGTGGGAGAGGTGGTGAAC
AAAAAAGCAGTCATGGCCGTGGGCTCCCTGACAATCAATG
AGGAGCGTTCAGAGGTCATCGATTTCTCCGTCCCCTTCGT
GGAAACAGGGATTAGTGTAATGGTATCCCGTAGCAACGGG
ACCGTCTCCCCATCAGCATTTTTAGAGCCCTTCAGTGCTT
CTGTGTGGGTGATGATGTTTGTGATGCTACTTCTGGTGAC
TGCAATGGCTGTCTTCATGTTTGAGTATATCAGCCCCCTG
GGCTTCAACAGGAACCTCGCTCAGGGCAAAGACCCCCACG
GACCGTCTTTCACCATGGGGAAAGCAGTGTGGCTCTTGTG
GGGCCTGGTGTTTAACAACTCTGTGCCTGTGCAAAACCCC
AAAGGCACGACCAGTAAATTCATAGTGTCAGTCTGGGCTT
TCTTCGCTGTCATCTTCCTGGCCAGTTACACTGCTAACCT
GGCTGCCTTCATGATCCAAGAGGAGTTTGTGGACCAAGTG
ACAGGCCTAAGTGACAAAAAGTTTCAGAGCCCCTACTCCT
ACTCTCCTCCTTTCCGCTTTGGAACGGTTCCAAACGGCAG
CACAGAGAGGAACATCCGAAAAAATTACCCCGACATGCAT
CAGTACATGGTGAAGTACCATCAGACCGGGGTGAATGATG
CACTGGTCAGCCTGAAAACTGGCAAACTTGATGCCTTCAT
TTATGATGCTGCTGTGCTGAACTATATGGCTGGTAGAGAC
GAGGGTTGTAAATTGGTGACCATTGGAAGTGGCTACATCT
TTGCTACCACTGGTTATGGCATTGCCCTCCAAAAGGGGTC
ACTCTGGAAGCGTCCGGTGGATCTGGCTATTCTCGCTATT
ATTGGAGATGGTGAGATGGAGGAGTTGGAGGCTCAGTGGC
TGACTGGAATCTGCCACAATGAGAAGAACGAGGTAATGAG
CAGCCAGCTGGATGTGGACAACATGGCTGGAGTGTTCTAC
ATGCTGGCGACTGCCATGGGTCTCAGCCTCATTACCTTTG
TCTGGGAGCACCTGTTCTACTGGAGACTCAGATACTGCTT
CACAGGCGTCTGCTCAGGCACGCCCGGCCTGCTCTTCTCC
ATCAGCAGGGGTATATGGAGTTGCATACATGGCGTCCATA
TCGATATGAAGAAAAAGTCTTCTGACCTGGACTTTAGTCC
ACAATCCAACATGCTTAAGCTTATCAAGTCTGCCAAACAG
ATGACTAATATGACCAACCTCAGTGGCTCCAGGATCAACT
CTCCTAAACGTGGCGGTGAGTTCATGCATTCAGCAAGCCC
AATGATCATGGACATGATGGCAGAGAAAGGGAACTTCATC
TACACCGACAATCGCAGCTATGCCCAAAAGGACATCTACG
GGGATTCCAGTGATTTGCAGTCATATCTGACTAACCGGCA
CAAGGACCATCTGAACAACTACATCTTTCAGGGTCAGCAT
CCCCTCACTCTCAATGAATCAAACCCCAATACTGTAGAGG
TGGCGGTGAGTGCAGACACAGCTCAGACCAATGCAAAACC
CAGAGCTCTGTGGAAGAAATCTGTGGATACTCTGCGTCAA
ACTCCTCAGGGTCCTGAAACCCTAGACCCCCGCTTGTCCA
TGAAGAGTCAGAGGTACCTGCCAGAGGACACCGCACACTC
AGATATCTCCGACTGCTCGAGCAGGGCCACCTCCTACAAG
GATCCAGACAATAACAAGCACCTGAAACCCAAGGATAACT
TAAAAAAAAGATCGATGACGTCAAAATACCCTAGGGATTG
CAGTGAAGTAGAGCTGTCCTACTTAAAAAATAAGCAGGGC
GGAGCGGGCCGGGAGAAAATATACACCATAGACTCTGACC
GGGAGCTGAGTCTGCACTCAGATCCACAGCACTACAGGGA
AGGCAGAGGCCTAACAACTGACGATTTGGATTTTGGCGAA
ATTTACTCCGACCACAATGACAATTACAGAAAATGCGACC
AGCCCATCATCCATCTCAACAGCAGCCCCATGCATCAAAG
TGAATCAGACCTCCTACCAGACAATGTCTACAATAAACAC
TACAGCTTGAAGGAGAAGAATATCAGTCCGCATGAAAGCA
ATGACCGGTTCAAACAGACTCATTGCAGGAGCTGCCTTTC
TAAGGTGCCCAACTACAACACAGGGCCGTACGCCGGCGCA
CGTTCGCCGTATAATCGATGCGAGGCGTGCCTCCACATGG
GCAACCTGTACGACATCAGTGAAGATCAGATGCTGCAGGA
GGCCATGATTAGCCCTAGCATGCACCATGATGACATGTTC
AGCCACTACTGGCCTCAGACGGATGGGCCACACGTACAGA
GGAGGAACAGACTGAAGCTTAGTCGTCAGCACTCCTTTGA
CAATATCATGCTCGAGAAGCCCAAAGAGATTGACCTGAAC
CGGCCGGCGCGAAGCGTCAGCCTAAAAGAGAAGGATCGCT
TCCTGGAGGACAGCCCTTATGCAAACATGTTTAACATTAA
GGCTGACAAACTGTTCGGCAGCAGGTCCATGCTCTTTAAC
CGAAACCTGGAGGAAAGCAAGCGTAGTAAGTCACTTTACC
CCGATCACCCCTCGGACAACCCCTTCATGCAATCTATACG
GGACGACACTCGCCTGGTCCACGGCAGGAGCTCCTCGGAT
ATTTACAAACAGTTGGCTCCCATCAAAGCCAGGAACGAGA
ACAATCTGAGGTCTTCTGTGAAATCCACCACTTCATACTG
TTCCAGGGATGGTCGAATACCCAATGACATGTACATTTCA
GAGCATGTAATGCCTTATGTAGCCAACAAGACTAGTGCAT
ACTCAGCTCCCCGGGTTCTCAACTCTTCGCAGTTTAGCAA
TAGACGAGTGTATAAGAAAATACCTAGTCTCGAGTCAGAT
GTTTAATGCTTTTTTGTGTAGTTGAAATATTTACTCACTT
AGAATGCCACAGTCACCTACATCTACAAAGTACCCGAGAT
ACCGCTCACGAGCGATTTCCAAAGGTTTCCAGCATTTTAA
GATGCTTTCTGGGCAGGTATCTGCAGAAAGACAGTTAGTC
AAGTGTAATTAAATGCGGTCCAGCATGGAAGTTTATTATC
CCCCACACTTGGCCTAATGCTAGTGTGTTCTCAAAACACA
GAGTGCTAGGGCGAATCTGAGGCTTCGAAGCTCTGAGCCG
AAGCCATGGTGGACCGAAGCAGATCTTAAGATGGGGTTTC
AGGTATTTGGCCCCATGTTGCATGTGACAAGAGCGTACCT
TTATTAGACAGACTGTGGCTGGAATAGCTCCTGAACTGAA
GTCAAGCAAGGGTATTTCATTCATGGCACTCAGCAATTGC
ATTTTTGCTTTTATTACTATAGACTCGGGATTTTTGGCAT
TCTAATCCCTATTTAGAATTTAGACTCTATCTTTCTCTAT
CTTATTTGGTAGCACAATAATCATTAGTTAACCGCCCACC
TCTGCTTTATAAACAGAACTTCTATATTACTGTCAGGAAT
AGATTTCTTTTGCATGTGTGTTTATTTTCCTGTCTTATTT
CGGTTGAAGATATACTTACATTAAGGTGATTTCATTTGAA
AGCTGAGGTGGTCATCTGTGCAATGAAAACTTGACCTGTA
TGTAAGTTGTTCGAATATTGTGTTGATCCTCCATTTGAAG
ATTGTGGGGAAGTTTTATCAATGGAAGTTTGTCTTGCATT
TCTTTTGTTCAGTACTTCCATCCCGTCACTGTACACTGTG
AAACCGAATCAGAGCATCACCTCTCGAAGACTGTTGTTTA
CTGTAGTTTGGTGGAGCCTGGCTGCGCTGTCGCAATCCAT
TCATTAAGTGTAACGAGGGCCGCATGTGAAGCTTGAAGTC
TGAACTAGAGCACTGGTTTTCTGTTGCAGTCCGTAACATG
ATCAACATGCTATTCGCATTGAGGACTACCATGCAAGACC
TTTGTTCTGCAGACCTATTACTAAACTTTATACTGTACGA
ACACACTCAATGAACTCCATGCAATGTGAATCAGAACACA
TAGCCAAATCGTGTAGATCAAATACCTCAGGATGGTTCTG
TGTCATTTTGTCTAACATTTTCTGTGCACTACTGAAAGGC
ACACTCACATTGCGTTTTGGCATGTTTCCCTTCACTTCGC
TATGGAGGTCTGAGGACTTCCATTGCGGTCGTGTTTATGT
GAACAGTAGAGAGAGGATCTTGCAGCCATCTCTGAAATGA
GCTTAATGTTTACGACTCCAACGTTTGTTGGAAAACAGGA
TGTGTATCGACGTGAACGTGTTTTATGACTGCTTTAGCAG
CTTCCACTCTCATATCAGACTTGATTTCTTTGAACTTCCC
CAATAATGTGACATAATTCACTGTACACTTATCTTGAATA
TGTCATCACTATCGTAATCATGAACATATTCATCATATGA
AGTGCTGCTTTAAGAAGCTAATGTGCGTATGCACATGTAA
AATATCAAGGTCGTGTAATCATATATATGCCATACATAGT
TTTTACTCTTTGCAACTTGTTTTTTCAGTTATTTTTTCAC
CCTTGTAATAACCCCAGTCTTTAAGGAAAATGTATTTTGA
TTACATGAACATGAATTATAATAATGGCATGCAACTCAAT
TGTAACTCTTTCTATGTTTTTGTTATGATGTAATGATCAC
AAATTATTTGTAACAGGGTGCAAATATAGCATATATATGG
AAAGAAAATGATCATTCATATTGCAGAGCTGCTGTTTTGG
GGAAATAAGCAAGGTATTAGCCTCTAGTATTAATCACAGA
GCCACATCTGCGTTGATTTCACATCCTATTTGAGGCGAGG
TGAATATGCTTGCTCTTCCTCGATTGGCAGGTAAAAACAT
CACCAGCTATGCTTTCTGTCTCCTGCCTGTCACATATAGC
CAGACTTAACCTGTAAAGGGAGAGAGAGAGAAAGGAAAAA
AAAAAGTCCTTATCCGGGTTGGCTATCCCTCCAAAGATAT
GACGTCTACTTTTTTTTTCTCTGTTATCTATGGTTTGCTG
TAAGAATAGAGCTTTTTTAATTCCTCAAAGACTTAGCAAC
TATTTTGAATATAAGACACTTGTAAATTGCTTGTAAATTC
ATACTCAAATAATTCATGAAAGTTACGATGATACAGAGTA
AATATTTTTTGTGTGGGTTTCACAGGTCTGTACAGTAGCA
CTCGTTTTCTGTAGCGTATGTCCGAAAAAAATGACATAAC
TCACAAGGTCTGCATCAAAACGAAACGTCACCTTACGAGA
CTTCCAAGTCTCCGTGCAGTTTGTTATCAGGGATTGTAGC
CCTGCAGTTTTTTCTAAGCTTGAACATTTTGGGCTGGGGT
GGGGTTGGGGGTGGGGCAGGTGTTGGGGCTACAGGCGTTG
CGGCAGATTTTTTCTAGTAAGGTAAATACTGTCAATTCAC
TTGAAGATGAGCAAGCAGATCAGTGGGAGGAAAACTGGCC
TCTTTGGTTCACACACATACAGTCGCGAAACTGCAGGGTA
CAAATCCATCCTGCTCATGAACCAAAGCTCTGTGGTCACT
CTGGCCTGTCGTTTAGGCCACCAGACTTCTGGGATTTATA
CACAAAAACATCTTGAAAACCAAAACGTACTTTTTACTTC
ATCGTTCTTTATTGGTTGAAGGTTATCGGAGGCGGTCAGA
TGGAACAGCGCAGGTCAGGTATTGATTGCAACTGGATACG
GATGAACTGTGTGGGGTTATTTTATGTAGCAGTTTTTGGC
TAGGCAAAAGCCATCTGTAGTTCATTTAAAAATATATATA
TTATATAGTATATATTTTTTGGTTTCATTTACCTCTGATA
GAATAGTACACAAATGTGAATTTAAAGTAGCTCAGATGCA
GATTATTTCCATAAGACGAGCTAGGCTAGGCACAGTAGTA
CAAGTCGGTAAGCAAGGATCTTTAAATCTCAGAAAAAAAA
AAAATTAGTACTTTCTCAACTACACCTTAAGCGCCGGTTA
AGGGTTAATCTGTTTTGTCCTTCACGTCTGTTACGCTCCA
CTTCTTTTAGCAGAGATCTGTGTTTGTGGATGATGAAGAA
AGGGCCTTTTTGGATCAGTGGCTAATGGCGTTCGGTCGCT
ATGCTGAACATTTAGACTTTAAAAGTCTTTTCAGATAACA
GAGATGCTGCCATCGCTAGTTTGTCTTTTATGAAAACCTA
TTACACCAAAAGATACATACAGAACCAATTTTCGTTCCTT
GTGAAGCATTATTTTTGACCGAGCAGGGCAGAATATCGAA
AAAGTGAAGCAGGGAAGTGAGACCGTTACTTAACAACACA
ATGGATCTCCTTCCAGGTCGCTTCTTCATCCACATGTAAG
ACCATTCGAAATCCATTCTTTCCCAAATTGATATTTTGCC
AAGTGCAGTGTAGTAAGAACAATAGGCGCTTTCGGCTGCC
AGGCAAGCTGTTGTACTGTCACTGCATCATTGGCTGAGTT
CCCATCGAGGTAGTTTCAAGGAGAAATCACCTCAGCTCAA
ATTACATCTGCCAGAGCCACACAAGGCACAGTGAGAAGGG
GCAGGTGGCTAAAGACAGGAGCGAGAGTCCTCATGCATGA
CTGTACCGACTCGCTCGCCTTCGTTCTCAGGCCGTTTTAT
AACCCTCAGGAGCAAAAAAACAAAATGGCAGCTTGGAAAC
AACACAAAAACACTCGCTGTCAGTCGTGGCTCTTTTAAGC
AATGCCATTTTAACTGATTATTATCTTCGCTCACCTTCGG
TTTAACAACTAAACGCTCTTCTTGATTTCTGTAATGCATT
TCTCGTGATGGATATTTGAAATCTTTAATTCTATGTTTGA
GCACAGAGCTGCTGGAACACTTGCACTTATTTAGGGACAA
AGGAACGCTGCCTTCCCTGTATAAATGACTATGATTATGA
CCCTAGTGGACTCACAATAAGGAAAGGAACATTGGTCTGA
AATGAATCACTTGTGTTTCATGTTTAATAATCACTCTCTT
GTGAGCTTTGCATTCATATTTTATGTAGTTACAAGTAGAA
CTTATTTTAGAGCAGTGTTTTATACAGGGGCGGGCGGGGA
TTGTCATGTGACTATAACCTATTTATCACTGAAACCATGT
GACCTGCTGCCTAAATGTTCTTTTATAATGAAGCATTATC
ACTCGTGTGCGTGCTGAAATGTCTTAAAAACTTTTTTTAA
CGTAAGTTGGAAGTAATCGCTTACACCAAGCTGACACAAA
CTCGCATAAATGAAATCATTTCTGCTATTGGCAAAATTGC
ATGAGAAAGTACTAATTCAGTGGGGCGGTTTGAACATATC
TCCTGTTCTCTCATTTTGTAACATAAAAGTATTGTGTTCG
GATTTTGTTTTGCGTTCTCTGCTTTTTTTTTAAGTGTATG
TAGATCATATTAAAGGAACAGGTCTGGTATGTGACTTGTG
AAATGTCAGTACAATGTGGTTGCAGGACGTGTGCTGGGTT
ACAAGATGTAAAAACATGTATATAAGTCAAAGTTTCATTT
TTCTAATAAAGGCTCTTTCTGCCACTTTATATGATCACTG
T

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations