Transcript

rps12-202

ID
ZDB-TSCRIPT-090929-9620
Name
rps12-202
Previous Names
  • rps12-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027032 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027032|OTTDARG00000021290|ZDB-GENE-030131-8951 rps12|OTTDARP00000022155 rps12-002 LG_ CR759830.8 Danio rerio protein_coding KNOWN, 499 bp
CGACACTATGACGTCCTCTTTACCCGCAGTCAGAGGGAAG
GAATAACTCCTCGCATCCATCGCTAATCTACAATGGCCGA
GGAAGGCATCGCTGCCGGAGGTGTGATGGATGTCAACACC
GCTCTGCCTGAAGTGCTGAAGACCGCACTCATCCACGACG
GTCTGGCCCGCGGTATCCGTGAGGCCGCCAAGGCCCTCGA
CAAGCGCCAGGCTCATCTTTGCGTCCTCGCTGCAAACTGT
GACGAGCCCATGTACGTCAAGCTGGTGGAGGCTCTCTGTG
CCGAGCATCAGATCAACCTCATCAAGGTTGATGACAATAA
GAAGCTCGGGGAATGGGTTGGTCTGTGTAAGATCGACAGA
GAGGGCAAACCCCGCAAGGTGGTGGGCTGCAGCTGTGTAG
TCATCAAGGACTACGGCAAAGAGTCCCAGGCTAAGGACGT
CATTGAAGAGTACTTCAAATCCAAGAAATAAGGCGCCAAA
TAAAATTGTTTGGAAAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations