Transcript

rps12-201

ID
ZDB-TSCRIPT-090929-9619
Name
rps12-201
Previous Names
  • rps12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027031 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027031|OTTDARG00000021290|ZDB-GENE-030131-8951 rps12|OTTDARP00000022154 rps12-001 LG_ CR759830.8 Danio rerio protein_coding KNOWN, 606 bp
CCCGCAGTCAGAGGGAAGGTAGGGCGAGCTTCTGAAATCT
CTGACACAATCGGTCTTAAATATTAACCATCCTGCCTTTA
AAATAACCCGAGATGCATCCAAAGCAACGGATATTAATAT
ATCCATCATATTATGTCTTTATTTCAGGAATAACTCCTCG
CATCCATCGCTAATCTACAATGGCCGAGGAAGGCATCGCT
GCCGGAGGTGTGATGGATGTCAACACCGCTCTGCCTGAAG
TGCTGAAGACCGCACTCATCCACGACGGTCTGGCCCGCGG
TATCCGTGAGGCCGCCAAGGCCCTCGACAAGCGCCAGGCT
CATCTTTGCGTCCTCGCTGCAAACTGTGACGAGCCCATGT
ACGTCAAGCTGGTGGAGGCTCTCTGTGCCGAGCATCAGAT
CAACCTCATCAAGGTTGATGACAATAAGAAGCTCGGGGAA
TGGGTTGGTCTGTGTAAGATCGACAGAGAGGGCAAACCCC
GCAAGGTGGTGGGCTGCAGCTGTGTAGTCATCAAGGACTA
CGGCAAAGAGTCCCAGGCTAAGGACGTCATTGAAGAGTAC
TTCAAATCCAAGAAATAAGGCGCCAAATAAAATTGTTTGG
AAAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations